Telic Thoughts is an independent blog about intelligent design.


« Getting With the Program
Information Filters »

Discerning Initial Options

by Bradford

What I'm really interested in is whether God could have made the world in a different way; that is, whether the necessity of logical simplicity leaves any freedom at all.- Albert Einstein

Einstein seems to have had Nature's constants in mind when he mused about constraints imposed by logical simplicity. Small adjustments in constant values could have resulted in a very different universe and not one hospitable to life. The musing has an unmistakable telic aspect to it. Is it even reasonable for us to expect that an empirical approach would yield answers to questions about ranges of constant values if we don't discern the initial cause for our resulting universe?

These icons link to social bookmarking sites where readers can share and discover new web pages.
  • Digg
  • Reddit
  • Mixx
  • StumbleUpon
  • YahooMyWeb
  • del.icio.us

This entry was posted on Wednesday, September 24th, 2008 at 8:33 am and is filed under Fine-tuning, Nature, Nature of Science. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response, or trackback from your own site. The trackback link is: http://telicthoughts.com/discerning-initial-options/trackback/

106 Responses to “Discerning Initial Options”

  1. The Pixie Again Says:
    September 24th, 2008 at 11:34 am

    Sounds to me like Einstein is thinking about a Designer who sets up the rules of the universe (including the constants you mention), and then leaves it to unwind, without any intervention on his part. That is a scenario I have no problem with; how about you?

    Would you call that ID? Personally I would not, because it does not leave evidence of the design, though I think Denton advocates this view, and counts himself an IDist.

  2. Comment by The Pixie Again — September 24, 2008 @ 11:34 am

  3. Bradford Says:
    September 24th, 2008 at 12:45 pm

    Pixie: Would you call that ID? Personally I would not, because it does not leave evidence of the design, though I think Denton advocates this view, and counts himself an IDist.

    I think there is evidence of design. The issue the question was meant to address was whether empircal methods are able to resolve the design/no design issue.

  4. Comment by Bradford — September 24, 2008 @ 12:45 pm

  5. Rob R. Says:
    September 24th, 2008 at 4:22 pm

    Pixie:

    Sounds to me like Einstein is thinking about a Designer who sets up the rules of the universe (including the constants you mention), and then leaves it to unwind, without any intervention on his part.

    [...]

    Would you call that ID?

    If I'm not mistaken, the agreed upon definition of ID is that certain patterns are best explained via intelligent processes. A designer who 'set up the rules' would work with that definition, no? A designer is inferred based on those rules i.e., patterns. Or are you guys going for something else?

    I'm not saying that Einstein, were he around today, would call himself an IDer (to be honest, I doubt he would) just that his position as you and Bradford have stated would fit in the 'big tent'. Deism seems almost a perfect fit for the idea/question: can we call something designed even if we have no knowledge of, or way of knowing, the identity of the designer.

    On a side note, why are you still having to use your new account Pixie? I would have assumed the TT tech guy (Guts, I believe) could have reset your password or given you a new one. No biggie, I just remember you asking for help with that and figured that would've been easy enough to fix. Just curious.

  6. Comment by Rob R. — September 24, 2008 @ 4:22 pm

  7. Bradford Says:
    September 24th, 2008 at 5:11 pm

    Rob R: Deism seems almost a perfect fit for the idea/question: can we call something designed even if we have no knowledge of, or way of knowing, the identity of the designer.

    I got this from the dictionary:

    Deism: The belief, based solely on reason, in a God who created the universe and then abandoned it, assuming no control over life, exerting no influence on natural phenomena, and giving no supernatural revelation.

    There are important distinctions. The reason above is not necessarily supported by specific biological or cosmological data. Nor are assumptions about God's control needed to support ID. Deism presumes a passive deity. ID holds to no position on that.

  8. Comment by Bradford — September 24, 2008 @ 5:11 pm

  9. Rob R. Says:
    September 24th, 2008 at 5:29 pm

    Hey Bradford,

    The reason above is not necessarily supported by specific biological or cosmological data.

    Perhaps. But, the definition you supplied, says it's based on "reason alone." I assume, for Deists, "reason" would be synonymous with data and/or evidence and/or the oft repeated "appearance of design." If not that, then from where to Deists derive their reasons to believe?

    Nor are assumptions about God's control needed to support ID.

    Agreed. Neither are assumptions of interventionism/theism necessary. Agreed?

    Deism presumes a passive deity. ID holds to no position on that.

    Neither does it exclude it or provide evidence against it. No? I assume I'm missing the point… or we agree, and I'm just dense. :???:

  10. Comment by Rob R. — September 24, 2008 @ 5:29 pm

  11. Bradford Says:
    September 24th, 2008 at 5:59 pm

    Rob R, you are not dense. We agree. You must be brilliant. :wink:

  12. Comment by Bradford — September 24, 2008 @ 5:59 pm

  13. Rob R. Says:
    September 24th, 2008 at 7:46 pm

    Bradford:

    You must be brilliant.

    Seems the only logical conclusion. [looks in mirror] September '75… God was having a GOOD day [blows kiss at self] [pats self on back]

    Okay, back to reality

  14. Comment by Rob R. — September 24, 2008 @ 7:46 pm

  15. Thought Provoker Says:
    September 24th, 2008 at 9:04 pm

    Hi Bradford,

    I read your opening post with mixed emotions. First of all, Sir Roger Penrose used the same Einstein quote in The Emperor's New Mind. Penrose used it during a discussion about the history of the entire universe being fixed for all time. This would be similar to the space-time Mandelbrot Set I have mentioned multiple times in other threads. This concept is a natural fallout of everything being interconnected in space and time.

    This is why I puzzle over your suggesting that it has an "unmistakable telic aspect" to it. It would agree that it could be viewed that way, but even I wouldn't call it "unmistakable". I'm not sure people would agree that the suggestion is that the universe is the way it must be implies purpose.

    It is kind of ironic that it is logical to conclude God had/has no free will.

  16. Comment by Thought Provoker — September 24, 2008 @ 9:04 pm

  17. Bradford Says:
    September 24th, 2008 at 9:39 pm

    TP: This is why I puzzle over your suggesting that it has an "unmistakable telic aspect" to it. It would agree that it could be viewed that way, but even I wouldn't call it "unmistakable". I'm not sure people would agree that the suggestion is that the universe is the way it must be implies purpose.

    The unmistakable telic aspect is a reference to Einstein's quote or musing as I put it. I realize that Einstein's view of the deity does not align with mine but his choice of words seems telic to me. I'm of the view that science is not an approach that can delineate between purpose and non-purpose where cosmology is concerned. I think Einstein would concur but perhaps you know of statements made by him which would indicate otherwise.

  18. Comment by Bradford — September 24, 2008 @ 9:39 pm

  19. fifth monarchy man Says:
    September 24th, 2008 at 10:02 pm

    TP:

    It is kind of ironic that it is logical to conclude God had/has no free will.

    Actually "God" could choose not to create the universe at all. This seems to me to be the ultimate expression of free will.

    Would you not agree?

  20. Comment by fifth monarchy man — September 24, 2008 @ 10:02 pm

  21. kornbelt888 Says:
    September 24th, 2008 at 10:04 pm

    Pixie: Sounds to me like Einstein is thinking about a Designer who sets up the rules of the universe (including the constants you mention), and then leaves it to unwind, without any intervention on his part.

    So is the universe deterministic or not? If it is, then all that exists was ordained from the start. If not, what is the source of any non-deterministic variability (read: magic) ? And I'm not speaking from our point of view, but absolutely.

  22. Comment by kornbelt888 — September 24, 2008 @ 10:04 pm

  23. JOHN_A_DESIGNER Says:
    September 24th, 2008 at 10:38 pm

    Bradford wrote:

    The unmistakable telic aspect is a reference to Einstein's quote or musing as I put it. I realize that Einstein's view of the deity does not align with mine but his choice of words seems telic to me. I'm of the view that science is not an approach that can delineate between purpose and non-purpose where cosmology is concerned. I think Einstein would concur but perhaps you know of statements made by him which would indicate otherwise.

    Anthony Flew would concur that nature points to some kind of deeper (or transcendent?) process. So does Paul Davies. In his book, There Is a God: How the World’s Most Notorious Atheist Changed His Mind, Flew quotes Davies 1995 Templeton address:

    Davies draws attention to the fact that the laws of nature underlying phenonmena are not found through direct observation. But extracted through experiment and mathematical theory. The laws are written in a cosmic code that scientists must crack in order to reveal the message that is “nature’s message, God’s message, take your choice, but not our message.”

    The burning question, he says, is threefold:

    “Where do the laws of physics come from?
    Why is it that we have these laws instead of some other set?
    How is that we have a set of laws that drives featureless gases to life, consciousness and intelligence?” P.107-108

    These laws “seem almost contrived– fine tuned, some commentators have claimed– so that life and consciousness may emerge.” He concludes that this “contrived nature of physical existence is just too fantastic for me to take on board as simply ‘given’. it points to a deeper underlying meaning to existence.” Such words as purpose and design, he says, only capture imperfectly what the universe is about. “But, that it is about something that I have absolutely no doubt.”

    Flew then quotes Davies again from another article:

    “Atheists claim that the laws [of nature] exist reasonlessly and that the universe is ultimately absurd. As a scientist, I find this hard to accept. There must be an unchanging rational ground in which the logical, orderly nature of the universe is rooted.” p111

    (Flew’s last quote is from Davies article, “What Happened Before the Big Bang?” God for the 21st Century, ed. Russell StannardTempleton foundation Press, 2000)

    These are questions about the ultimate nature of the universe. These are questions that both philosophers and theologians explore. These are not the kind of questions that can be explored by what we call natural science.

  24. Comment by JOHN_A_DESIGNER — September 24, 2008 @ 10:38 pm

  25. Thought Provoker Says:
    September 25th, 2008 at 12:36 am

    Hi Fifth Monarchy Man,

    Actually "God" could choose not to create the universe at all. This seems to me to be the ultimate expression of free will.

    Would you not agree?

    How does a timeless, omniscient being decide not to do what he/she/it has already done?

    Free will is what happens when you give fallible humans too much power. Humans will abuse the power just because they have it. Howver, the power to erase the universe before its creation is meaningless if it is never used. A perfect being always acts perfectly, by definition. Since the universe exists, I suggest it is safe to presume it is supposed to exist.

    To hearken back to the objective morality thread…

    would an omnibenevolent God not do something he/she/it is supposed to
    do?

  26. Comment by Thought Provoker — September 25, 2008 @ 12:36 am

  27. Thought Provoker Says:
    September 25th, 2008 at 12:54 am

    Hi kornbelt888,

    You wrote…

    So is the universe deterministic or not? If it is, then all that exists was ordained from the start. If not, what is the source of any non-deterministic variability (read: magic) ?

    Excellent question and topical too. I suggest this is what Einstein was touching on with the quote of the opening post.

    Does God play Quantum Mechanical dice? Or is it a wicked game of billiards that must play out the way it did and does?

    If I understand Penrose correctly, he suggests that Quantum Mechanics is neither deterministic nor random.

    I suggest it is rather clear quantum effects are not random. There are too many experiments that show the quantum effects are influenced by observation and "spooky action at a distance". Penrose also makes an argument from Kurt Gödel's Incompleteness Theorem that it is possible for a logic system to be non-deterministic. This, coupled with Penrose's quantum gravity hypotheses suggests that our universe is a non-deterministic logic system that isn't random.

  28. Comment by Thought Provoker — September 25, 2008 @ 12:54 am

  29. The Pixie Again Says:
    September 25th, 2008 at 5:32 am

    Rob R.

    If I'm not mistaken, the agreed upon definition of ID is that certain patterns are best explained via intelligent processes. A designer who 'set up the rules' would work with that definition, no? A designer is inferred based on those rules i.e., patterns. Or are you guys going for something else?

    We live in a universe that seems finely tuned for life. One scenario is that it was designed to be that. Another scenario is that countless (and perhap infinite) universes have appeared, but the vast majority collapse with a very short time, and many more are not suitable for the development of life; inevitiably we live in one that is suitable for life. Do you think there is some way we can determine that the fine-tuning of the constants is actually an intelligently designed pattern? If so, then I will agree that that is ID. I am not aware of anyone making that claim.

    On a side note, why are you still having to use your new account Pixie? I would have assumed the TT tech guy (Guts, I believe) could have reset your password or given you a new one. No biggie, I just remember you asking for help with that and figured that would've been easy enough to fix. Just curious.

    I tried a few times over a couple of weeks to use the password reset facility, I informed the TT management, and it was not fixed, so I am still using this. Not tried again recently though.

    kornbelt888

    So is the universe deterministic or not? If it is, then all that exists was ordained from the start. If not, what is the source of any non-deterministic variability (read: magic) ? And I'm not speaking from our point of view, but absolutely.

    I think QM shows the universe is not deterministic, that God does indeed play with dice (though I know other people will disagree). I see no reason to equate quantum randomness with magic, though…

    TP

    I suggest it is rather clear quantum effects are not random. There are too many experiments that show the quantum effects are influenced by observation and "spooky action at a distance".

    I am no expert on QM however… Einstein's "spooky action at a distance" relates to quantum entanglement, in which the state of one particle is influenced be another, at some distance (for example, if particle A is spin up, then particle B must be spin down). However, this is in o way at odds with the two particles being in a random state (i.e., the state of B is determined by A, but the state of A is random).

    When you say "quantum effects are influenced by observation" do you mean that the state after the wave collapse in determined (or influenced) by the observer? I have not heard of that. I am aware of theories that say that observation causes the collapse, but that still allows the final state to be random.

    Just what is it that counts as an observer anyway? Are animal observers? How about jellyfish, which have eyes but no brains? A plant or bacteria? At what point does a person become an observer (moment of birth, conception, some point during gestation, etc.) and how does that transition occur (does it start with just occasional collapses, or just very local, or is it an all or nothing thing)? Can a machine be an observer (a Geiger counter, or an AI)?

  30. Comment by The Pixie Again — September 25, 2008 @ 5:32 am

  31. Raevmo Says:
    September 25th, 2008 at 6:14 am

    Isn't it a little inconsistent to believe both that (1) God created the universe with its physical laws in such a way that life could develop in it, and (2) abiogenesis is impossible without some additional bursts of magic from Him? It seems to me that folks like Bradford are claiming that God could not have created a universe which would allow a fully natural origin of life. Or would God get bored if he didn't get to mess with his design from time to time? Is that it?

    [PS Bradford, you haven't answered my question how it is "codified" that gay sex is immoral]

  32. Comment by Raevmo — September 25, 2008 @ 6:14 am

  33. Bradford Says:
    September 25th, 2008 at 6:49 am

    Raevmo: Isn't it a little inconsistent to believe both that (1) God created the universe with its physical laws in such a way that life could develop in it, and (2) abiogenesis is impossible without some additional bursts of magic from Him? It seems to me that folks like Bradford are claiming that God could not have created a universe which would allow a fully natural origin of life.

    That's not my claim. I believe God could have created a universe which would allow for an origin of life in accordance with laws governing the universe he created. God could make life an inevitable outcome of a set of conditions. The question around which my origins claim is based is: Does nature indicate that cells arise as a result of a series of chemical reactions? My answer to that is no. As for your morality question it would have to be pursued in another thread. I thought you understood my morality is scriptually based. If you do then you are indicating an unawareness of the relevant scriptural passages. They will be supplied elsewhere.

  34. Comment by Bradford — September 25, 2008 @ 6:49 am

  35. fifth monarchy man Says:
    September 25th, 2008 at 7:13 am

    TP,

    How does a timeless, omniscient being decide not to do what he/she/it has already done?

    I don’t think such a being could but then again my God is not “timeless” but eternal and immutable in his nature. There is a big difference

    Free will is what happens when you give fallible humans too much power. Humans will abuse the power just because they have it.

    Exactly and this is 100 percent predictable. Yet humans decide to do so freely. Quite a paradox huh

    Howver, the power to erase the universe before its creation is meaningless if it is never used.

    How so?

    I have the power to do lots of thing that I never do because they are against my nature.

    A perfect being always acts perfectly, by definition. Since the universe exists, I suggest it is safe to presume it is supposed to exist.

    Correct and a perfect being (if it's God)does what is right because he wants to not because he has to

    would an omnibenevolent God not do something he/she/it is supposed to
    do?

    For combatilists like me free will means the freedom to do what you want. The sad truth is because were selfish we want to do evil and not good.

    If the gift of existence is a good thing an omnibenevolent being would want to create the universe. And if he has free will he would do it.

    simple logic

    Carry on, my head hurts

    Peace

  36. Comment by fifth monarchy man — September 25, 2008 @ 7:13 am

  37. Zachriel Says:
    September 25th, 2008 at 9:52 am

    Bradford: I realize that Einstein's view of the deity does not align with mine but his choice of words seems telic to me.

    A bunch of knobs that have to be precisely adjusted to result in a universe capable of sustaining life. Or Einstein's notion that this is the only logically possible universe, a single button with no parameters. The former is often suggested as 'evidence' of teleology.

    fifth monarchy man: Actually "God" could choose not to create the universe at all.

    Perhaps. It is also possible the "nothingness" is inherently unstable. In other words, not even a button is required.

    The Pixie Again: We live in a universe that seems finely tuned for life. One scenario is that it was designed to be that. Another scenario is that countless (and perhap infinite) universes have appeared, but the vast majority collapse with a very short time, and many more are not suitable for the development of life; inevitiably we live in one that is suitable for life.

    We have seen many disparate phenomena explained as due to some underlying symmetry, such as the equivalence of inertial mass and gravitational mass, the unification of the electric force and magnetic force, and the peculiar flatness of the cosmos. There is evidence to suggest that other forces also have an underlying unity, and perhaps even space and time.

    This is the heart of Einstein's idea, though the EPR paradox and studies of the cosmic background radiation imply that quantum indeterminacy may underly the structure of the cosmos.

    Bradford: God could make life an inevitable outcome of a set of conditions. The question around which my origins claim is based is: Does nature indicate that cells arise as a result of a series of chemical reactions? My answer to that is no.

    Your answer appears inconsistent. Life is an inevitable consequence of the creation of the cosmos, but also life is not inevitable, and some sort of intervention is required. Or at least something other than chemistry, perhaps an inevitable telic causation, not organic life.

  38. Comment by Zachriel — September 25, 2008 @ 9:52 am

  39. kornbelt888 Says:
    September 25th, 2008 at 10:06 am

    Pixie: I see no reason to equate quantum randomness with magic, though…

    Fine. What is it's source?

  40. Comment by kornbelt888 — September 25, 2008 @ 10:06 am

  41. The Pixie Again Says:
    September 25th, 2008 at 10:38 am

    What is it's source?

    Does randomness need a source? What makes you think that? I thought the point was that randomness is not determined by something else, i.e., there is no source.

  42. Comment by The Pixie Again — September 25, 2008 @ 10:38 am

  43. Thought Provoker Says:
    September 25th, 2008 at 12:54 pm

    Hi Pixie,

    You wrote…

    I am no expert on QM however… Einstein's "spooky action at a distance" relates to quantum entanglement, in which the state of one particle is influenced be another, at some distance (for example, if particle A is spin up, then particle B must be spin down). However, this is in o way at odds with the two particles being in a random state (i.e., the state of B is determined by A, but the state of A is random).

    But the state of A is dependent on the state of B! The fundamental problem with "spooky action at a distance" is the hint of retrocausality. Both cause and effect are linked. Quantum experiments like delayed choice and delayed choice erasure makes this two way interconnectiveness hard to deny (people continue to try anyway).

    When you say "quantum effects are influenced by observation" do you mean that the state after the wave collapse in determined (or influenced) by the observer? I have not heard of that. I am aware of theories that say that observation causes the collapse, but that still allows the final state to be random.

    It is generally called the Copenhagen Interpretation. I suggest saying randomness is behind it all is as much of a presumed belief as believing a supernatural being is doing it. There is no direct evidence of either. Both are metaphysical presumptions.

    Just what is it that counts as an observer anyway? Are animal observers? How about jellyfish, which have eyes but no brains? A plant or bacteria? At what point does a person become an observer (moment of birth, conception, some point during gestation, etc.) and how does that transition occur (does it start with just occasional collapses, or just very local, or is it an all or nothing thing)? Can a machine be an observer (a Geiger counter, or an AI)?

    [queue the twilight zone music]

    "You're traveling through another dimension — a dimension not only of sight and sound but of mind. A journey into a wondrous land whose boundaries are that of imagination. That's a signpost up ahead: your next stop:…"

    The EPR paradox.

    The questions you are asking have been asked and investigated by many very intelligent people. The basic situation is the quantum dual slit experiment. If the "observer" looks for individual particles going through through individual slits that observer sees that. Consequently, the resulting pattern of "random", multiple detections is an even distribution. However, if the observer presumes wavelike behavior and is purposely ignorant of the which-way information of particles going through slits, a wave-like diffraction pattern results.

    The quantum observation effect has also been called the "measurement problem" with the presumption that the actual detection is what is causing the effect. However, it turns out that it is the information that matters not the measurement. Using entangled photons it is possible to know the which-way information of one photon by measuring its twin AFTER the original photon has already contributed to whatever pattern is being created.

    Logically, an even-distribution pattern should always show up if the which-way information is available. However, it is possible to intentionally lose the which-way information before it is observed. If the information is "erased" after the fact the diffraction pattern shows up from the original photons.

    Once the data is known (i.e. observed) the Objective Reduction (Penrose's term) of involved quantum effects occurs.

    This is why Penrose feels that consciousness must be directly entangled with quantum effects. It makes sense that conscious observations are just as much part of the "spooky action at a distance" as two entangled photons going in opposite directions.

    Cause and effect are directly interconnected in both space and time at the quantum level.

  44. Comment by Thought Provoker — September 25, 2008 @ 12:54 pm

  45. Raevmo Says:
    September 25th, 2008 at 1:59 pm

    Bradford:

    I believe God could have created a universe which would allow for an origin of life in accordance with laws governing the universe he created. God could make life an inevitable outcome of a set of conditions. The question around which my origins claim is based is: Does nature indicate that cells arise as a result of a series of chemical reactions? My answer to that is no.

    So you believe that God could have created a universe where life originates without his further assistance, but that your take on the evidence (or lack thereof) indicates that he didn't. Well, I suppose you might be right, but in that case God's work does lack a certain elegance that I would have expected from a perfect deity.

    As for your morality question it would have to be pursued in another thread. I thought you understood my morality is scriptually based. If you do then you are indicating an unawareness of the relevant scriptural passages. They will be supplied elsewhere.

    I'm looking forward to that. It's true that my awareness of scriptural passages is pretty bad. I'm ashamed to admit that I have never read the Bible in its entirety. Nor the Koran for that matter.

  46. Comment by Raevmo — September 25, 2008 @ 1:59 pm

  47. Thought Provoker Says:
    September 25th, 2008 at 6:02 pm

    Hi fifth monarchy man,

    …my God is not “timeless” but eternal and immutable in his nature. There is a big difference

    That's interesting when you consider that time is a dimension contained WITHIN the universe. I suggest only timeless entities could possibly exist outside the universe where time doesn't exist.

    And, of course, there is also the observation that something that is immutable doesn't have an ability to learn (i.e. isn't "intellegent") with questionable free will.

    I have the power to do lots of thing that I never do because they are against my nature.

    The only distinction between "won't" and "can't" is the possibility of acting contrary to one's nature. A perfect being can't act in a contrary manner and remain perfect. A perfect being can't abuse his/her/its power and remain perfect. A power that can't be used is meaningless, even in an omnipotent being.

    Carry on, my head hurts

    Is this a sign of provoked, independent thinking?

  48. Comment by Thought Provoker — September 25, 2008 @ 6:02 pm

  49. fifth monarchy man Says:
    September 25th, 2008 at 7:11 pm

    TP

    I suggest only timeless entities could possibly exist outside the universe where time doesn't exist.

    Prehaps but my God exists both inside and outside the universe It's called the incarnation and it's the main point of Christianity.

    of course, there is also the observation that something that is immutable doesn't have an ability to learn (i.e. isn't "intellegent") with questionable free will.

    My God is a Being made up of three persons each person is always loving and always communicating always experiencing and always praising the other persons eternally.

    Amazing things can happen when when an immutable being exists in relationship.

    On top of that one person of the Trinity exists at in union with a human nature

    So it can be said that he is at the same time immutable and grows in wisdom and stature (Luke 2:40 , Heb 13:8) cool huh

    The Trinity and Hypostatic union two more vital planks to Christianity

    The only distinction between "won't" and "can't" is the possibility of acting contrary to one's nature

    If I'm forced to act contrary to my nature (my will) it's not free will, it's slavery and unless I'm compelled otherwise I will always act according to my nature.

    That’s what free will means IMHO.

    Surely as someone who throws around philosophical catch phrases you are familiar with the never ending debate between folks who think like I do and folks who disagree. I don't expect us to settle that one here. But I will say in philosophical circles mine is probably the majority view.

    A perfect being can't abuse his/her/its power and remain perfect. A power that can't be used is meaningless.

    Who said He can't use his power the point is he won't because his nature is to be perfect.

    In the same way you could use your power to act against your nature but you wont because if you did you would no longer be you.

    simple

    If this does not make sense I would again point you to the mountains of information written about Compatibilist freewill over the past 4 thousand years.

    Is this a sign of provoked, independent thinking?

    No it's a sign of the difficulty of trying to express complex truths in short sentences on an internet forum.

    Peace

  50. Comment by fifth monarchy man — September 25, 2008 @ 7:11 pm

  51. Thought Provoker Says:
    September 25th, 2008 at 9:57 pm

    Hi fifth monarchy man,

    So it can be said that he is at the same time immutable and grows in wisdom and stature (Luke 2:40 , Heb 13:8) cool huh.

    You should know by now that I will quote bible references you make.

    Luke 2:36-43

    36And there was one Anna, a prophetess, the daughter of Phanuel, of the tribe of Aser: she was of a great age, and had lived with an husband seven years from her virginity;

    37And she was a widow of about fourscore and four years, which departed not from the temple, but served God with fastings and prayers night and day.

    38And she coming in that instant gave thanks likewise unto the Lord, and spake of him to all them that looked for redemption in Jerusalem.

    39And when they had performed all things according to the law of the Lord, they returned into Galilee, to their own city Nazareth.

    40And the child grew, and waxed strong in spirit, filled with wisdom: and the grace of God was upon him.

    41Now his parents went to Jerusalem every year at the feast of the passover.

    42And when he was twelve years old, they went up to Jerusalem after the custom of the feast.

    43And when they had fulfilled the days, as they returned, the child Jesus tarried behind in Jerusalem; and Joseph and his mother knew not of it.

    Yes, it is "cool" to know that the man named Yeshua Ben Yosef was once a boy who grew up and didn't always do what his parents expected.

    Heb 13:1-10
    1 Let brotherly love continue.

    2 Be not forgetful to entertain strangers: for thereby some have entertained angels unawares.

    3 Remember them that are in bonds, as bound with them; and them which suffer adversity, as being yourselves also in the body.

    4 Marriage is honourable in all, and the bed undefiled: but whoremongers and adulterers God will judge.

    5 Let your conversation be without covetousness; and be content with such things as ye have: for he hath said, I will never leave thee, nor forsake thee.

    6 So that we may boldly say, The Lord is my helper, and I will not fear what man shall do unto me.

    7 Remember them which have the rule over you, who have spoken unto you the word of God: whose faith follow, considering the end of their conversation.

    8 Jesus Christ the same yesterday, and to day, and for ever.

    9 Be not carried about with divers and strange doctrines. For it is a good thing that the heart be established with grace; not with meats, which have not profited them that have been occupied therein.

    I'm not quite sure why you think this is an overly significant passage. Whether I like it or not, even president Bush has been very consistent. Bush; the same yesterday, and today and forever. The Bush legacy has been all but carved in stone, mostly in blood.

    Maybe this would be a good time to bring up one of Pez's favorite passages…

    Matthew 19:16,17

    16 And, behold, one came and said unto him, Good Master, what good thing shall I do, that I may have eternal life?

    17 And he said unto him, Why callest thou me good? there is none good but one, that is, God: but if thou wilt enter into life, keep the commandments.

    You wrote…

    The Trinity and Hypostatic union two more vital planks to Christianity

    While I still think it was the actions of Paul and his contemporaries (e.g. Luke) who were most responsible for Christianity's popularity, it is amazing the mileage St. Augustine and his contemporaries (e.g. St. Cyril of Alexandria) got with their spin on dogma three centuries later.

    Thank you for giving me the opportunity to show that I’m not totally focused on the Councils of Nicaea and their installation of the Trinity. I understand it was the Council of Chalcedon who were responsible for Hypostatic union becoming enforced dogma.

    Even though St. Cyril had died 7 years before they met, Cyril's influence was very much present at the Council of Chalcedon.

    Surely as someone who throws around philosophical catch phrases you are familiar with the never ending debate between folks who think like I do and folks who disagree. I don't expect us to settle that one here. But I will say in philosophical circles mine is probably the majority view.

    And when Islam becomes the dominant religion, will that mean theirs will become the Ultimate Truth?

    While Islam teaches there will be a second coming of the Messiah, they aren't too keen on the Trinity idea.

    Who said He can't use his power the point is he won't because his nature is to be perfect.

    In the same way you could use your power to act against your nature but you wont because if you did you would no longer be you.

    simple

    It is simple because I'm not perfect whereas God, by definition, is.

    With God there isn't anything he might or might not do there is only perfection. Anything different is less than perfect.

    With reference to the opening post, God doesn't have "any freedom at all".

    If this does not make sense I would again point you to the mountains of information written about Compatibilist freewill over the past 4 thousand years.

    You reference mountains of information rather than give a simple explanation showing what you agree to.

    It is ironic that my Quantum Quackery worldview allows for a kind of compatibility freewill due to the interconnectedness of cause and effect. I have been waiting to the opportunity to explore that with someone, but I suspect you aren't prepared to offer and defend your own, independent thinking much less compare and contrast it with mine. It looks like you would rather let the "majority view" and "mountains of information" do your thinking for you while you cling to your pious humility.

  52. Comment by Thought Provoker — September 25, 2008 @ 9:57 pm

  53. fifth monarchy man Says:
    September 25th, 2008 at 10:00 pm

    Zach:

    It is also possible the "nothingness" is inherently unstable. In other words, not even a button is required.

    unstable nothingness LOL is that any thing like loud silence or bright darkness? So what other properties does something that by definition is property- less have?

    nothingness

    –noun
    1. the state of being nothing.
    2. something that is nonexistent: a view of humanity as suspended between infinity and nothingness.
    3. lack of being; nonexistence: The sound faded into nothingness.
    4. unconsciousness or death: She remembered a dizzy feeling, then nothingness.
    5. utter insignificance, emptiness, or worthlessness; triviality: The days followed one another in an endless procession of nothingness.
    6. something insignificant or without value.

  54. Comment by fifth monarchy man — September 25, 2008 @ 10:00 pm

  55. Thought Provoker Says:
    September 25th, 2008 at 10:20 pm

    Hi Fifth Monarchy Man,

    Still having trouble with imagining a geometry that would allow for square circles?

    It turns out that the geometry of our observed universe disallows absolute nothingness. Observations made by Heisenberg provide more insight than originally understood.

    “Nothingness” can be a thought of as a zero mass particle with no momentum. That violates the axiom that we can never know both the position and momentum of a particle. Therefore, “nothingness” is unstable and is constantly creating pairs of matched particles. One with positive mass the other with negative mass. Most of the time they just recombine. However, there are situations where they don’t.

  56. Comment by Thought Provoker — September 25, 2008 @ 10:20 pm

  57. Zachriel Says:
    September 25th, 2008 at 10:46 pm

    fifth monarchy man: unstable nothingness

    You are aware that matter and energy pop in and out of existence in a vacuum.

    (A vacuum state is not quite "nothingness", but let's start with what we know before speculating about what we don't know.)

  58. Comment by Zachriel — September 25, 2008 @ 10:46 pm

  59. fifth monarchy man Says:
    September 25th, 2008 at 10:48 pm

    TP:

    Wow trotting out the old Da Vinci code argument and politics in the same post. You’ve outdone yourself

    While I still think it was the actions of Paul and his contemporaries (e.g. Luke) who were most responsible for Christianity's popularity, it is amazing the mileage St. Augustine and his contemporaries (e.g. St. Cyril of Alexandria) got with their spin on dogma three centuries later.

    While I find your knowledge of Christian history good for a few laughs what does this have to do with my comments?

    It really does not matter where the doctrines of the Trinity or the hypostatic union comes from. We are having a philosophical discussion and philosophically speaking a god like the Christian God can have free will can learn while being immutable and eternal at the same time. Don’t you agree?

    And when Islam becomes the dominant religion, will that mean theirs will become the Ultimate Truth?

    While Islam teaches there will be a second coming of the Messiah, they aren't too keen on the Trinity idea.

    Again I’m not sure what this has to do with whether the Christian God can have freewill or if he has to be timeless. What am I missing?

    I'm not quite sure why you think this is an overly significant passage. Whether I like it or not, even president Bush has been very consistent. Bush; the same yesterday, and today and forever. The Bush legacy has been all but carved in stone, mostly in blood.

    So is Bush immutable? I can’t say how you can fathom that in a week when he proposed the biggest socialist expansion of government in the history of our country a plan devised and supported mostly by democrats.

    What about the surge Bush was fighting for Rumsefield’s Iraqi strategy for years but did an about face?

    Everyone knows about his conversion experience when he changed over night from a drunk to a teetotaler.

    Stupid maybe but not immutable.

    It is simple because I'm not perfect whereas God, by definition, is.
    So?

    Do you have the power to do what is( perfect) right morally speaking in any given situation. I say you do. will you do such a thing if it against your own nature of course not.

    With God there isn't anything he might or might not do there is only perfection. Anything different is less than perfect.

    The exact opposite is the case for the natural man your point is? The fact is neither you nor god will act in a way that is contary to your nature

    With reference to the opening post, God doesn't have "any freedom at all".

    If God does not, neither do you. You both act according to you natures all the time.

    You reference mountains of information rather than give a simple explanation showing what you agree to

    .
    How’s this from Hobbs

    "no liberty can be inferred to the will, desire, or inclination, but the liberty of the man; which consisteth in this, that he finds no stop, in doing what he has the will, desire, or inclination to doe.

    but I suspect you aren't prepared to offer and defend your own, independent thinking.

    I can defend my thinking all day but I supect you don't really care what others think. At least not enough to do a little research.

    Peace

  60. Comment by fifth monarchy man — September 25, 2008 @ 10:48 pm

  61. JOHN_A_DESIGNER Says:
    September 25th, 2008 at 11:33 pm

    Pixie wrote:

    We live in a universe that seems finely tuned for life. One scenario is that it was designed to be that. Another scenario is that countless (and perhap infinite) universes have appeared, but the vast majority collapse with a very short time, and many more are not suitable for the development of life; inevitiably we live in one that is suitable for life. Do you think there is some way we can determine that the fine-tuning of the constants is actually an intelligently designed pattern? If so, then I will agree that that is ID. I am not aware of anyone making that claim.

    Are you looking for some kind of scientific proof? Personally I don’t think of ID as a scientific theory but as a broad philosophical/conceptual framework. I believe that Anthony Flew also approaches the subject of the existence of design and a designer from a philosophical/conceptual rather than scientific perspective. Indeed, in his recently published book, There Is a God, he writes:

    “You might ask how I how I, a philosopher, could speak to issues treated by scientists. The best way to answer this is with another question. Are we engaging in science or philosophy here? When you study the interaction of two physical bodies, for instance, two sub atomic particles, you are engaged in science. When you ask how it is that those subatomic particles– or anything physical– could exist or why, you are engaged in philosophy. When you draw philosophical conclusions from scientific data, then you are thinking as a philosopher.” P89

    By it’s a very nature empirical science is reductionistic. Philosophy and theology, on the other hand, deal with the big picture, they try to see the world holistically rather than reductionistically. However, philosophy, theology and science do share some common ground. They both try to objectively analyze evidence. Philosophy and theology, however, as Flew says above, seeks to discover what the evidence means. For example, what type of world do we live in? Is there or isn’t there some ultimate meaning to it all?

    Flew continues:

    “I must stress that my discovery of the Divine has proceeded on a purely natural level, without any reference to supernatural phenomena. It has been an exercise in what is traditionally called natural theology. It has connection with any of the revealed religions. Nor do I claim to have had any personal experience of God or any experience that may be called supernatural or miraculous. In short, my discovery of the Divine has been a pilgrimage of reason not of faith.” P93

    Ironically, it was while as a member of C.S Lewis’s Socratic Club that Flew embraced the Socratic principle “of following the evidence wherever it may lead…” He writes that this principle “became the guiding principle in the development, refinement , and sometimes reversal of my own philosophical views.” (p41)

    Of course, recently Flew made a major reversal when he embraced Theism. To his credit Flew has always tried to keep an open mind and has always been civil in his discourse. For example, as one of the worlds leading atheists he has never any problem forming genuine and lasting friendships with theists and Christian theists. He understood that demonizing your opponents never accomplishes anything. Honestly understanding their arguments does.

  62. Comment by JOHN_A_DESIGNER — September 25, 2008 @ 11:33 pm

  63. Bradford Says:
    September 25th, 2008 at 11:41 pm

    Hi TP. You wrote:

    I'm not quite sure why you think this is an overly significant passage. Whether I like it or not, even president Bush has been very consistent. Bush; the same yesterday, and today and forever. The Bush legacy has been all but carved in stone, mostly in blood.

    Your sentiments about Bush are typical of many people. I've read that Bush is a liar who cannot be trusted etc. I've read this sort of thing even at Telic Thoughts, a blog not known for much political commentary. Here is my question for you: Are you hoping that Congress will respond to the Bush initiative by providing 700 billion dollars in bail out money ostensibly necessary for the sake of our economy?

    BTW, kindly respond in the open thread if you do respond.

  64. Comment by Bradford — September 25, 2008 @ 11:41 pm

  65. The Pixie Again Says:
    September 26th, 2008 at 5:48 am

    Hi Thought Provoker

    But the state of A is dependent on the state of B!

    The state of the A-B system is random; it could be up-down or down-up.

    The fundamental problem with "spooky action at a distance" is the hint of retrocausality. Both cause and effect are linked. Quantum experiments like delayed choice and delayed choice erasure makes this two way interconnectiveness hard to deny (people continue to try anyway).

    But these appear to be about when wavefunction collapse occurs, rather than what state it collapses into. I see nothing to argue against the state being random. Are we (and I do include myself) getting confused with the wave vs particle thing? How we observe the system determines whether it acts as a wave or a particle. If it is a wave, then that wave is a probability function, and the ultimate state is random within that probability distribution. I think.

    It is generally called the Copenhagen Interpretation.

    I had a quick read of the Wiki article on the Copenhagen Interpretation; in particular I noted "Consciousness causes collapse is often confused with the Copenhagen interpretation". Perhaops you can clarify what you are claiming here.

    I suggest saying randomness is behind it all is as much of a presumed belief as believing a supernatural being is doing it. There is no direct evidence of either. Both are metaphysical presumptions.

    I disagree. If you hypothesis that the decay of a radioisotope is entirely random (i.e., each atom has a set probability of decaying within a set time span), then you would predict that the amount of radioisotope will follow an exponential decay. This prediction fits the observation. If you hypothesis that energy is distributed at random around a system, then you would predict that hot things cool to ambient, and cold things warm to ambient. This prediction fits the observation (we call it the second law of thermodynamics).

    These do not prove that quantum effects are random, but they do offer pretty good support to the claim.

    The questions you are asking have been asked and investigated by many very intelligent people.
    …
    This is why Penrose feels that consciousness must be directly entangled with quantum effects. It makes sense that conscious observations are just as much part of the "spooky action at a distance" as two entangled photons going in opposite directions.
    Cause and effect are directly interconnected in both space and time at the quantum level.

    None of this actually addresses the questions I asked. What is it that Penrose or any other of these "many very intelligent people" think counts as an observer? This is a fundamental issue.

    If Penrose et al. have any evidence at all that a conscious observer is required, then logically they should be able to use that to detect consciousness. If an experiment works one way only with a conscious observer, then the should be able to hook a mouse in there, and thereby determine if the mouse is conscious. I am not aware of anyone doing what to me seems a very interesting experiment on the nature of consciousness, which leads me to suspect that no one can do such an experiment, which in turn leads me to suspect that actually there is no experimental support for a conscious observer.

  66. Comment by The Pixie Again — September 26, 2008 @ 5:48 am

  67. The Pixie Again Says:
    September 26th, 2008 at 6:20 am

    John A Designer

    Are you looking for some kind of scientific proof?

    If we consider the hypothesis that the universe was fine-tuned for life, and the designer had no further involvement, then is that ID Dembski, among others, defines ID as the claim that life was designed and there is evidence of that design. Therefore, if we would expect to find evidence of design in this scenario, then it is ID. On the other hand, if such a universe would be indistinguishable from the multiverse universe, then this scenario would not fall under the ID label. That was all I meant.

    On the wider issue of ID, yes I am looking for some kind of scientific proof (or rather, supporting evidence). Afterall ID tries to present itself as some sort of science.

    By it’s a very nature empirical science is reductionistic. Philosophy and theology, on the other hand, deal with the big picture, they try to see the world holistically rather than reductionistically. However, philosophy, theology and science do share some common ground. They both try to objectively analyze evidence. Philosophy and theology, however, as Flew says above, seeks to discover what the evidence means. For example, what type of world do we live in? Is there or isn’t there some ultimate meaning to it all?

    That is fine up to a point. However, when you start with a philosophical position (including a religion position) and you cling to that despite the scientific evidence against it, then you have bad philosophy (or bad theology). This is certainly what YECers do. From what I have seen - not much - I have no reason to suppose that Flew does that; he has certainly not embraced Christianity (clearly the evidence did not lead him there!).

  68. Comment by The Pixie Again — September 26, 2008 @ 6:20 am

  69. fifth monarchy man Says:
    September 26th, 2008 at 7:20 am

    Zach:

    You are aware that matter and energy pop in and out of existence in a vacuum.

    Yes and an apple comes from an apple tree. So what?
    A vacuum is not nothingness as you point out. So looking at what happens in a vacuum tells us noting about nothingness.

    Out of nothing nothing nothing comes by definition .

    TP

    Still having trouble with imagining a geometry that would allow for square circles?

    Yea that blasted law of non contradiction can be a real drag on independent thought :lol:

    It turns out that the geometry of our observed universe disallows absolute nothingness.

    So looking at what happens in our observed universe tells us nothing about what happens in nothingness I’m sure you know this but still you bring it up. Why?

    Peace

  70. Comment by fifth monarchy man — September 26, 2008 @ 7:20 am

  71. Zachriel Says:
    September 26th, 2008 at 8:27 am

    fifth monarchy man: A vacuum is not nothingness as you point out.

    Please don't ignore the argument. The claim is the it is possible that nothingness is unstable just as empty space is unstable.

    fifth monarchy man: Out of nothing nothing nothing comes by definition .

    No. That is not the definition.

  72. Comment by Zachriel — September 26, 2008 @ 8:27 am

  73. willo Says:
    September 26th, 2008 at 7:07 pm

    Hi Zachriel:

    If nothing is unstable isn't that something?

  74. Comment by willo — September 26, 2008 @ 7:07 pm

  75. fifth monarchy man Says:
    September 26th, 2008 at 9:39 pm

    Hey Zach:

    My comments must have got caught in the spam filter
    If they don’t show up soon I will repost responses later

    willo:

    If nothing is unstable isn't that something?

    Of course it is

    Not to get to technical but sometimes common sense is a difficult thing to grasp

    Unstable is an accidental property and nothingness can have no such properties because it has nonexistence as it’s substance. A nonexistent thing can’t have properties

    nothingness can't be unstable

    It’s really that simple.

    Peace

  76. Comment by fifth monarchy man — September 26, 2008 @ 9:39 pm

  77. JOHN_A_DESIGNER Says:
    September 27th, 2008 at 1:02 am

    Pixie wrote:

    If we consider the hypothesis that the universe was fine-tuned for life, and the designer had no further involvement, then is that ID Dembski, among others, defines ID as the claim that life was designed and there is evidence of that design.

    Consider the following sequence:
    CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG
    TCTAAAACTGGGAGTTGATAAGGGTCTGCAATTAGA

    Does it show evidence of design? How can you tell? It looks rather random, doesn‘t it? Is it random? How could you tell?

    On the wider issue of ID, yes I am looking for some kind of scientific proof (or rather, supporting evidence). After all, ID tries to present itself as some sort of science.

    Like I said above I don’t think ID in it’s present form is a scientific theory or even a nascent scientific theory. Indeed, I think it has been a mistake to push in it’s present form as a scientific theory.

    That is fine up to a point. However, when you start with a philosophical position (including a religion position) and you cling to that despite the scientific evidence against it, then you have bad philosophy (or bad theology).

    The point that I was trying to make is that you need to look very honestly and objectively at all the evidence. OTOH if you come to the evidence with a lot of preconceptions, then why bother? The former is the way to avoid bad science, bad philosophy and bad theology. I think Flew does this. I think that Mike Gene does this in his book, The Design Matrix. Indeed, the “design matrix” is a way to detect design.

    From what I have seen - not much - I have no reason to suppose that Flew does that; he has certainly not embraced Christianity (clearly the evidence did not lead him there!).

    Curiously, Flew includes a dialogue with N.T. Wright, a noted New Testament scholar, as an appendix of his book, There Is a God: How the World’s Most Notorious Atheist Changed His Mind. The appendix is entitled: “The Self-Revelation of God In Human History: A Dialogue on Jesus with N.T. Wright” What is interesting is the way Flew concludes the dialogue and his book.
    He writes:

    "I am very much impressed with Bishop Wright’s approach, which is absolutely fresh. He presents the case for Christianity as something new for the first time. This is enormously important, especially in the United Kingdom, where the Christian religion has virtually disappeared. It is absolutely wonderful, absolutely radical, and very powerful.

    Is it possible that there has been or can be divine revelation? As I said, you cannot limit the possibilities of omnipotence except to produce the logically impossible. Everything else it open to omnipotence."

    Is Flew making an endorsement here? Probably not. But neither is he rejecting the Christian faith as something that is irrational.

  78. Comment by JOHN_A_DESIGNER — September 27, 2008 @ 1:02 am

  79. Thought Provoker Says:
    September 27th, 2008 at 1:40 am

    Hi Fifth Monarchy Man,

    You wrote…

    Yea that blasted law of non contradiction can be a real drag on independent thought

    You do realize that a presumption of logic and "non contradiction' is a philosophical position, right?

    The basics of philosophy are inherently contradictory and not entirely logical.

    The Tao that can be told is not the eternal Tao;
    The name that can be named is not the eternal name.
    'Nothingness' is the beginning of heaven and earth.
    'Oneness' is the mother of everythings.
    Ever desireless, one can see the mystery.
    Ever desiring, one can see the manifestations.
    These two spring from the same source but differ in name; this appears as darkness.
    Darkness within darkness.
    The gate to all mystery.

    Those who embrace NOMA don't have a problem with contradictory philosophy. Science presumes logic and a universal nature (i.e. "non contradiction'). Philosophy and religion, on the other hand, has a different ruleset.

    Kind of like unusual geometries where the shortest distance between two points is NOT a straight line or where square circles can exist.

    So looking at what happens in our observed universe tells us nothing about what happens in nothingness I’m sure you know this but still you bring it up. Why?

    Why are you are now talking about a metaphysical property that has no relationship to something observable?

    nothingness can't be unstable

    How do you know if it can NEVER be observed?

    Nothingness could be the ultimate in unstable chaos.

    Or, better yet, nothingness could be God.

    Sometimes you sound like you are a materialist who believes in solid particles. "Matter" is just a form of nothingness.

  80. Comment by Thought Provoker — September 27, 2008 @ 1:40 am

  81. Thought Provoker Says:
    September 27th, 2008 at 2:53 am

    Hi Pixie,

    You wrote…

    The state of the A-B system is random; it could be up-down or down-up.

    That is a presumption on your part. Another presumption is that a supreme being is behind it all.

    The presumption I am suggesting is that all quantum effects are interconnected to all other quantum effect throughout space and time.

    This amount of complex information would be indistinguishable from randomness, yet not be random. Similar to a pseudo-random number generator. Looks random, has an even distribution, but isn't random.

    It is difficult to make the case against randomness with the two entangled state problem, but the three entangled state problem (Greenberger–Horne–Zeilinger) makes things a little more interesting. Did you read my The Magic of Intelligent Design post?

    The lack a randomness in these types a quantum systems allows for the ultimate in secure communication links. It is secure because any observation of the information by any means would destroy the communication link and be detected. There are working demos of these types of devices. The may be in actual use, but it would be in places we probably aren't supposed to know about.

    But these appear to be about when wavefunction collapse occurs, rather than what state it collapses into. I see nothing to argue against the state being random.

    It is obvious that in certain circumstances a single quantum state isn't independently random (it depends on the states of one or more other quantum states). How do you know where to draw the boundary for the system that is independently random compared to everything else?

    I had a quick read of the Wiki article on the Copenhagen Interpretation; in particular I noted "Consciousness causes collapse is often confused with the Copenhagen interpretation". Perhaops you can clarify what you are claiming here.

    Penrose's OR interpretation is a Copenhagen derivative. Penrose/Hameroff Orch OR model is based on the OR interpretation and explicitly hypothesizes that consciousness causes collapse.

    Schrödinger proposed his cat-based thought experiment as an attempt to demonstrate how ridiculous the Copenhagen interpretation was. However, over the years it became the puzzle nobody could solve. I understand Schrödinger regretted ever proposing it.

    In the Hawking/Penrose debate it was Penrose who was arguing that the answer to the Schrödinger cat problem was key with Hawking trying to downplay its importance.

    I disagree. If you hypothesis that the decay of a radioisotope is entirely random (i.e., each atom has a set probability of decaying within a set time span), then you would predict that the amount of radioisotope will follow an exponential decay. This prediction fits the observation. If you hypothesis that energy is distributed at random around a system, then you would predict that hot things cool to ambient, and cold things warm to ambient. This prediction fits the observation (we call it the second law of thermodynamics).

    Nice try, but we all know it was the other way around. The exponential decay was observed and randomness was presumed.

    These do not prove that quantum effects are random, but they do offer pretty good support to the claim.

    And we have pretty good support for the claim that 3D space is flat and time is absolute. At least we did until we made observations that didn't fit the presumption.

    None of this actually addresses the questions I asked. What is it that Penrose or any other of these "many very intelligent people" think counts as an observer? This is a fundamental issue.

    Hameroff/Penrose suggests most, if not all, living organisms possess some consciousness.

    If Penrose et al. have any evidence at all that a conscious observer is required, then logically they should be able to use that to detect consciousness. If an experiment works one way only with a conscious observer, then the should be able to hook a mouse in there, and thereby determine if the mouse is conscious. I am not aware of anyone doing what to me seems a very interesting experiment on the nature of consciousness, which leads me to suspect that no one can do such an experiment, which in turn leads me to suspect that actually there is no experimental support for a conscious observer.

    The universe conspires to prevent cheating. How would you propose to test for the case of non-observation? Recording for later observation gets treated as observed. The delayed choice erasure experiment comes close.

    I will try to find a better example of an experiment.

  82. Comment by Thought Provoker — September 27, 2008 @ 2:53 am

  83. The Pixie Again Says:
    September 27th, 2008 at 11:45 am

    TP

    Pix: The state of the A-B system is random; it could be up-down or down-up.

    TP: That is a presumption on your part. Another presumption is that a supreme being is behind it all.

    Okay, how is "presumption" different to "assumption" here?

    I already gave evidence supporting the hypothesis that wave functions collapse into random states. I have yet to see anything to support the supreme being hypothesis.

    The presumption I am suggesting is that all quantum effects are interconnected to all other quantum effect throughout space and time.

    I think that is probably true in some way. I wonder if the whole universe is one big wavefunction. Scientists are obliged to take a reductionist approach, looking at single atoms, and even then only very simple atoms (at least, that was the case 20 years ago when I did QM course at college), when the reality is that the wavefunction at least covers the entire molecule.

    Quantum collapse then would be a change in the one universal wavefunction which would necessarily be evolving over time. Whether the one universal wavefunction changes into one state or another can still be random.

    This amount of complex information would be indistinguishable from randomness, yet not be random. Similar to a pseudo-random number generator. Looks random, has an even distribution, but isn't random.

    Could be. But so far everything seems consistent with random, and it seems the most parsimonous solution.

    The lack a randomness in these types a quantum systems allows for the ultimate in secure communication links. It is secure because any observation of the information by any means would destroy the communication link and be detected. There are working demos of these types of devices. The may be in actual use, but it would be in places we probably aren't supposed to know about.

    If you are correct that physisists have already determined that QM is not random. Now it could be that that discovery has been kept secret becuse of the applications you mention, but I think such a finding is too profound to keep quiet. As far as I know no such findng has happened. Do you know any differently?

    It is obvious that in certain circumstances a single quantum state isn't independently random (it depends on the states of one or more other quantum states). How do you know where to draw the boundary for the system that is independently random compared to everything else?

    Some events lead to paired particles, and the state of one depends on the state of the other. Why should we imagine that interdependance exists in systems without paired particles?

    Penrose's OR interpretation is a Copenhagen derivative.

    Before you said; "It is generally called the Copenhagen Interpretation", now it is a derivitive of the Copenhagen Interpretation. Rather different. Frankly, you damage your reputation when you quietly change your position like this. If you made a mistake, have the honesty to admit, rather than pretend it never happened. It makes me wonder about the rest of your arguments, and I would have expected better of you.

    Nice try, but we all know it was the other way around. The exponential decay was observed and randomness was presumed.

    Nevertheless, exponential decay is a necessary consequence of randomness, and so it is a scientifically valid prediction. The data matches the prediction.

    One of the freat, early successes of relativity was that it successfully predicts the orbit of Mercury. And yet the orbit of Mercury was already known!

    And we have pretty good support for the claim that 3D space is flat and time is absolute. At least we did until we made observations that didn't fit the presumption.

    So? Get the observation that do not fit the randomness hypothesis, and you have a point. But not until then.

    Hameroff/Penrose suggests most, if not all, living organisms possess some consciousness.

    So Schoedinger's cat was capable of collapsing the wave function, in their opionion? Indeed, if Schoedinger has a daffodil in a box, that would have been enough to cause the wave function to collapse, so would not be in two states.

    How about an embryo or an amoeba? Where do they draw the line? And how do that rationalise it?

  84. Comment by The Pixie Again — September 27, 2008 @ 11:45 am

  85. fifth monarchy man Says:
    September 27th, 2008 at 2:15 pm

    TP

    You do realize that a presumption of logic and "non contradiction' is a philosophical position, right?

    That's quite a claim please prove it with out presuming logic or relying on the law of non contradiction. I’m all ears.

    The basics of philosophy are inherently contradictory and not entirely logical.

    Again prove that statement using those rules. This should be interesting.

    The Tao that can be
    told is not the eternal Tao;

    The name that can be named is not the eternal
    name.

    'Nothingness' is the beginning of heaven and
    earth.

    'Oneness' is the mother of everythings.

    Ever desireless, one can see the mystery.

    Ever desiring, one can see the manifestations.

    These two spring from the same source but differ
    in name; this appears as darkness.

    Darkness within darkness.

    The gate to all mystery.

    Eastern holy men and community college professors sometimes utter nonsense in order to sound deep to their students but in the end it’s still nonsense. If you disagree please explain what any of these things means. I’ll be waiting.

    Those who embrace NOMA don't have a problem with contradictory philosophy

    That is why NOMA is so dangerous it leads to nonsense. The world needs clear thinking now more than ever.

    Kind of like unusual geometries where the shortest distance between two points is NOT a straight line or where square circles can exist.

    I have no problem with unusual geometries where the shortest distance between two points is not a straight line. No contradiction there. But square circles can’t exist even in an imaginary world.

    Why are you are now talking about a metaphysical property that has no relationship to something observable?

    Who said nothingness has no relationship to something observable? It has the relationship of opposites? The same way that square has a relationship to circle or silence has a relationship to noise.

    me: nothingness can't be unstable

    You: How do you know if it can NEVER be observed?

    Logic. Try it some time It’s the sportsman’s friend :wink:

    Nothingness could be the ultimate in unstable chaos.

    Or, better yet, nothingness could be God

    .

    Please explain how. I can’t wait. Remember nonsense is not an explanation.

    "Matter" is just a form of nothingness.

    Saying something does not make it so. You need to prove and I would love to hear you try to prove nonsense.

    Peace

  86. Comment by fifth monarchy man — September 27, 2008 @ 2:15 pm

  87. Thought Provoker Says:
    September 27th, 2008 at 4:26 pm

    Hi Pixie,

    Thank you for your continued interest. Excuse me while I reorder the topics. I suggest the mixing of various concepts is causing confusion.

    You asked…

    Okay, how is "presumption" different to "assumption" here?

    To me, an assumption implies a logical necessity (a "given"). If an assumption is wrong, everything that follows falls apart.

    I look at a presumption as a default placeholder. Scientifically, it doesn't really matter if the universal source is divine, random or a multi-dimensional Mandelbrot Set. That is a philosophical position.

    If you want to presume that the universal source of variation is random, fine. The problem starts when people try to extrapolate their philosophical presumptions as if they are scientific Truths for all.

    You wrote…

    Before you said; "It is generally called the Copenhagen Interpretation", now it is a derivitive of the Copenhagen Interpretation. Rather different. Frankly, you damage your reputation…

    I was trying to be helpful. You seem to be struggling for a name when you said "I am aware of theories that say that observation causes the collapse, but that still allows the final state to be random." Waveform collapse is GENERALLY known as the Copenhagen Interpretation as opposed to those who generally ascribe to Many World Interpretation.

    As usual, no good deed goes unpunished.

    Penrose's Copenhagen derivative (Objective Reduction) refers to the wave-form as a wave-function. I suggest this is to emphasis there aren't different forms of objects, everything is a wavefunction.

    I wonder if the whole universe is one big wavefunction.

    Congratulations. You are understanding the ramifications of Penrose's OR interpretation. Yes, Penrose is suggesting the universe is a four dimensional wavefunction and vice versa. That merges the quantum realm and relativistic space-time realm. (If Oleg is listening in, I suspect he is rethinking his no-comment stance about now).

    Quantum collapse then would be a change in the one universal wavefunction which would necessarily be evolving over time. Whether the one universal wavefunction changes into one state or another can still be random.

    But wait a minute. Four dimensional space-time does not change over time. Time is part of the wavefunction not outside it.

    The non-locality of the EPR paradox implies interconnectedness in time as well as space. Faster-than-light quantum communication inherently involves time.

    Quantum experiments like delayed choice and delayed choice erasure directly support the retrocausality nature of Quantum Mechanics. Quantum effects are interconnected in time as well as space.

    Ergo, the quantum wavefunction includes all four dimensions of space-time.

    The concept of the wavefunction changing over time (randomly or otherwise) is complicated by this.

    An analogy is to think of a Mandelbrot Set. It can be thought of as random in the way a psuedo-random number or digits of PI can be thought of as random.

    A four-dimensional Mandelbrot Set would appear to be dynamically changing if looked at as the time coordinate was varied. Digits of PI look like random numbers that change digit by digit.

    I suggest questions on how this space-time wavefunction came to be are metaphysical and should be addressed by philosophers or theologians, not scientists.

    Note: up to this point a role for consciousness is neither assumed nor presumed.

    Here is a link to a paper titled Time and the Quantum: Erasing the Past and Impacting the Future It discusses the time aspect of quantum experimental aspects. It also touches on the effects observation has an Quantum Mechanics.

    As to QM's measurement problem which I would call an observation problem you wrote…

    Get the observation that do not fit the randomness hypothesis, and you have a point. But not until then.

    The Greenberger–Horne–Zeilinger (GHZ) quantum states extends a very not random interaction beyond pairs. Three, four or more quantum states are shown to be interconnected.

    Here is a link to a scientific paper on how GHZ is using in secure communication…

    "[Based] on the idea of dense coding of three-photon entangled state and qubit transmission in blocks, we present a multiparty controlled quantum secret direct communication scheme using Greenberger-Horne-Zeilinger state. In the present scheme, the sender transmits her three bits of secret message to the receiver directly and the secret message can only be recovered by the receiver under the permission of all the controllers."

    Once again, how and where do you draw a boundary around what is and isn't independently random. If you want to presume the entire universal wavefunction is random, go ahead.

    Penrose's OR would be complete without addressing consciousness if it wasn't for things like GHZ states showing an effect of observations.

    We are well past seriously arguing intrusive instrumentation is the culpret. It is the information that is causes a change in quantum states, not the method of obtaining the information.

    In the quantum delayed choice erasure experiment here are the basic, unbreakable rules…

    1. A non-diffraction pattern appears if the which-way information is available.

    2. A diffraction pattern appears if the which-way information isn't available.

    3. The system will remain in superposition of both states for as long a possible.

    According to Penrose, there is a timelimit as to how long the system can maintain the superposition based on the mass involved. Since photons are massless, something with mass must be included which is also in superposition and relevant to information communication.

    The Orch OR presumption is that tubulin dimers are intentionally included (possibly via evolution) in the superposition system to allow life to be "aware" if its environment. In other words, "consciousness".

    Consciousness can retain information like which-way. Consciousness would force a system to collapse to a single state.

    This would explain why observation forces superposition collapse.

    What is your alternative hypothesis to explain quantum experimental observations like delayed choice erasure?

    (Warning, this is a VERY HARD problem which has forced very intelligent people to propose very extreme explanations (e.g. Many World).

  88. Comment by Thought Provoker — September 27, 2008 @ 4:26 pm

  89. Thought Provoker Says:
    September 27th, 2008 at 4:47 pm

    Hi Fifth Monarchy Man,

    You wrote…

    That is why NOMA is so dangerous it leads to nonsense. The world needs clear thinking now more than ever.

    What we have here is a "failure to communicate".

    You believe you know the Truth for all of us.

    Hat Tip to Paul Newman who died today.

  90. Comment by Thought Provoker — September 27, 2008 @ 4:47 pm

  91. fifth monarchy man Says:
    September 27th, 2008 at 6:25 pm

    You believe you know the Truth for all of us.

    If "the Truth" exists wouldn’t it be for all of us?

    Is NOMA itself a claim to the Truth?
    For that matter is claiming to not know the Truth itself the ultimate Truth claim?

    I know I know There I go again using more of that cursed logic :lol:

    Peace

  92. Comment by fifth monarchy man — September 27, 2008 @ 6:25 pm

  93. The Pixie Again Says:
    September 27th, 2008 at 7:46 pm

    Hi TP

    I was trying to be helpful. You seem to be struggling for a name when you said "I am aware of theories that say that observation causes the collapse, but that still allows the final state to be random." Waveform collapse is GENERALLY known as the Copenhagen Interpretation as opposed to those who generally ascribe to Many World Interpretation.

    Okay. I thought we were talking specifically about a conscious observer, and really I was not bothered how we labelled it, until you seemed to be labelling it wrong. So let us move on.

    Penrose's Copenhagen derivative (Objective Reduction) refers to the wave-form as a wave-function. I suggest this is to emphasis there aren't different forms of objects, everything is a wavefunction.

    Surely everything is a wave is fundamental to QM?

    Congratulations. You are understanding the ramifications of Penrose's OR interpretation.

    My issue here is whether this is unique to Penrose. I would guess not, but if it it, this is something I have concluded for myself, without looking at Penrose's claims. It seems to me an inevitable conclusion, and I doubt it is only me and Penrose who have arrived at it.

    But wait a minute. Four dimensional space-time does not change over time. Time is part of the wavefunction not outside it.

    But a temporal being who experiences linear time will observe the four dimensional space-time as something that changes over time. Also, I am unconvinced that that is how the wavefuncion works.

    The non-locality of the EPR paradox implies interconnectedness in time as well as space. Faster-than-light quantum communication inherently involves time.
    Quantum experiments like delayed choice and delayed choice erasure directly support the retrocausality nature of Quantum Mechanics. Quantum effects are interconnected in time as well as space.
    Ergo, the quantum wavefunction includes all four dimensions of space-time.

    I think the support for retrocausality is shaky at best.

    An analogy is to think of a Mandelbrot Set. It can be thought of as random in the way a psuedo-random number or digits of PI can be thought of as random.

    That is an interesting idea. Okay, so all the evidence points to random or pseudo-random. I doubt we can tell the difference, and in a sense I do not think there is a difference. But still no evidence to any intelligence behind it all.

    The Greenberger–Horne–Zeilinger (GHZ) quantum states extends a very not random interaction beyond pairs. Three, four or more quantum states are shown to be interconnected.

    But this is still very much a special situation. See this page where they describe how they got three photons entangled. It seems to me that the experimenters could tell exactly when it happened and when it did not. There is no fuzzy boundary here. In certain circumstances particles can be entangled, but those are rare, contrived situations, as far as I can tell.

    In GHZ systems, is the overall state of the system random? That is the real issue here.

    Penrose's OR would be complete without addressing consciousness if it wasn't for things like GHZ states showing an effect of observations.

    Do you mean specifically observation by a conscious agent? If not, then we have no argument, but I assume (or perhps presume) you do.

    If GHZ states show the effects of being observed by a conscious agent, then you have basis of a device for determining consciousness. Expose the sample agent to the GHZ states, and see if the sample agent causes the effects effected for a conscious agent. It would be possible to tell once and for all whether rats or ant or bacteria or dafodils are conscious. And yet no one has done that. This makes me think it is not possible, which makes me think that GHZ states are not affected specifically by conscious agents.

    We are well past seriously arguing intrusive instrumentation is the culpret. It is the information that is causes a change in quantum states, not the method of obtaining the information.

    So now we are asking whether that information has to be in a conscious mind, recorded in a computer chip, recorded in the response of a detector or even just the excitation of a molecule. My feeling is that the use of the term information here does more to obfuscate than to explain.

    According to Penrose, there is a timelimit as to how long the system can maintain the superposition based on the mass involved. Since photons are massless, something with mass must be included which is also in superposition and relevant to information communication.

    Right, so the photon impinges on a photosensitive molecule, exciting it. The molecule has mass, and is capable of receiving the information, and that is enough to cause wavefunction collapse (this is what I guess happens, by the way, though I can offer no support, I freely admit).

    The Orch OR presumption is that tubulin dimers are intentionally included (possibly via evolution) in the superposition system to allow life to be "aware" if its environment. In other words, "consciousness".

    Well, I am unconvinved. I find the idea that one type of molecule is particularly tuned to pick up QM messages to be incredible. All molecules are wavefunctions, all will respond to QM nteractions. The difference come down to resonance frequencies and things like that.

    The environment of these tubulin dimers is the cells they are in. Sure, they will feel the effects of events outside the body, but that will be tiny, tiny, tiny compared to what is going on in the cell membrane.

    And personally I would not describe consciousness as merely awareness of your surroundings, but perhaps you could give as Penrose's definition..

    Consciousness would force a system to collapse to a single state.

    Sure, but so do all molecules.

    This would explain why observation forces superposition collapse.

    Sure, including observation by a molecule.

    What is your alternative hypothesis to explain quantum experimental observations like delayed choice erasure?

    It is the same, except that the observation is done at a much earlie point in the experiment. What I like about my theory, compared to yours, is that the tricky questions about what counts as consciousness becomes irrelevant. I see you dodged that question, which is no surprise, as I am sure there is no answer. No one can detect consciousness, no one can be sure if an ant or a daffodil is conscious. I find that pretty damning for Penrose.

  94. Comment by The Pixie Again — September 27, 2008 @ 7:46 pm

  95. Thought Provoker Says:
    September 27th, 2008 at 8:09 pm

    Hi Fifth Monarchy Man,

    You wrote…

    I know I know There I go again using more of that cursed logic.

    But you didn't present logic.

    Only a lack of imagination and a bunch of questions implying an extreme fear of uncertainty.

  96. Comment by Thought Provoker — September 27, 2008 @ 8:09 pm

  97. fifth monarchy man Says:
    September 27th, 2008 at 8:29 pm

    TP

    But you didn't present logic.
    Only a lack of imagination and a bunch of questions

    Those were rhetorical questions that logically had only one answer.
    I’m sure you know that rhetorical questions are different than garden verity questions like this one.

    Does my confidence that I know the Truth (a person not a proposition) scare you?

    implying an extreme fear of uncertainty.

    Not a fear of uncertainty just a healthy contempt of misplaced certainty masquerading as uncertainty.

    Peace

  98. Comment by fifth monarchy man — September 27, 2008 @ 8:29 pm

  99. Thought Provoker Says:
    September 28th, 2008 at 12:17 am

    Hi Pixie,

    You have demonstrated a willingness to consider the implications much further than a lot of people. It speaks well of you.

    You wrote…

    Surely everything is a wave is fundamental to QM?

    You would think, wouldn't you?

    It seems to me an inevitable conclusion, and I doubt it is only me and Penrose who have arrived at it.

    You appear to be more willing to accept the reality of a universal wavefunction than quite a few other people I have talked to.

    But a temporal being who experiences linear time will observe the four dimensional space-time as something that changes over time. Also, I am unconvinced that that is how the wavefuncion works.

    Getting cold feet?

    Wouldn't the parsimonious assumption be that the geometry of a universal wavefunction is the same as the geometry of the universe?

    If you are suggesting the temporal being's view changes as he travels through a static four dimensional space-time universe, I agree.

    But, I don't understand why you are suggesting a four dimensional space-time wavefunction wouldn't work.

    I think the support for retrocausality is shaky at best.

    Please try to excuse my use of the term "retrocausality". Unfortunately, it suggests an acceptance of the possibility of causal paradoxes which is not what I am stating. Even though quantum entanglement can occur symmetrically back and forth in time, causal paradoxes, in a classical sense, can not happen.

    The Delayed Choice and Delayed Choice Erasure experiments were set up explicitly to test quantum time symmetry. The results show the quantum entanglement work the same in both forward and backward time directions.

    Is the evidence “shaky” or are the implications so uncomfortable that you see it in terms of extraordinary claims requiring extraordinary evidence?

    Other than a demonstration of a causal paradox which we both assume can’t happen, what experimental evidence would it take to convince you that quantum entanglement is symmetrical with respect to time as well as space?

    Do you understand how the Delayed Choice Erasure experiment works? Try this link.

    But this is still very much a special situation. See this page where they describe how they got three photons entangled. It seems to me that the experimenters could tell exactly when it happened and when it did not. There is no fuzzy boundary here. In certain circumstances particles can be entangled, but those are rare, contrived situations, as far as I can