Telic Thoughts is an independent blog about intelligent design.


« The Culture War
Contemplating Design »

Science News: Mutations, viruses, and brains

by MikeGene

We often think of mutations as "mistakes." But in my opinion, the real Mistake would exist if feedback and adjustment were not made possible:

Intestinal colonization of germ-free mice by E. coli was followed by the very rapid selection of bacteria carrying mutations in a master regulator that controls and coordinates the expression of over 100 target genes. The important selective advantage conferred by the mutations was related with their additive and independent effects on genes regulating bacterial motility and permeability.

These results suggest that global regulators may have evolved to coordinate physiological activities necessary for adaptation to complex environments and that mutations offer a complementary genetic mechanism to adjust the scale of the physiological regulation controlled by these regulators in distinct environments.

-Here

Viruses can seduce us into thinking that life can be simple. But viruses exist and propagate only because cellulary machinery exist:

In some ways, HIV resembles a minimalist painter, using a few basic components to achieve dramatic effects. The virus contains just nine genes encoding 15 proteins, which wreak havoc on the human immune system. But this bare bones approach could have a fatal flaw. Lacking robust machinery, HIV hijacks human proteins to propagate, and these might represent powerful therapeutic targets.

Using a technique called RNA interference to screen thousands of genes, Harvard Medical School researchers have now identified 273 human proteins required for HIV propagation. The vast majority had not been connected to the virus by previous studies.

-Here

Life is multi-tasking. Check out what helps the developing human brain:

Synapse elimination occurs during the normal development of a child's brain, but until now, no one knew how certain synapses were flagged for removal. "We have identified the long-mysterious mechanism by which excess synapses are sculpted away in the developing brain," said the study's senior author, Ben Barres, in the journal Cell.
Barres' team found that the brain-sculpting process was controlled by a component of the immune system known as the classical complement cascade. The complement cascade is one part of the multipronged attack the immune system launches throughout the body when it detects a foreign invader.
-Here

And let's not forget culture. Brains are different.

These icons link to social bookmarking sites where readers can share and discover new web pages.
  • Digg
  • Reddit
  • Mixx
  • StumbleUpon
  • YahooMyWeb
  • del.icio.us

This entry was posted on Saturday, January 12th, 2008 at 11:29 am and is filed under Biology. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response, or trackback from your own site. The trackback link is: http://telicthoughts.com/science-news-mutations-viruses-and-brains/trackback/

113 Responses to “Science News: Mutations, viruses, and brains”

  1. Bradford Says:
    January 12th, 2008 at 2:31 pm

    These results suggest that global regulators may have evolved to coordinate physiological activities necessary for adaptation to complex environments and that mutations offer a complementary genetic mechanism to adjust the scale of the physiological regulation controlled by these regulators in distinct environments.

    Suggesting downward causation as the correct lense through which to view function.

    Mike Gene:

    Viruses can seduce us into thinking that life can be simple. But viruses exist and propagate only because cellulary machinery exist:

    Reminds me of exchanges over self-correcting genomic mechanisms and arguments that viruses show that correction mechanisms are not a prerequisite to maintaining genomic integrity. The biological machinery enabling viral replication does include correction mechanisms though and much more than that.

  2. Comment by Bradford — January 12, 2008 @ 2:31 pm

  3. hrun Says:
    January 13th, 2008 at 2:41 pm

    Hi Bradford: Which self-correcting genomic mechanisms are actually prerequisite to maintaining genomic integrity? If memory serves me right, one can disrupt numerous error-correction mechanisms in yeast without actually disrupting the viability of yeast.

  4. Comment by hrun — January 13, 2008 @ 2:41 pm

  5. Bradford Says:
    January 13th, 2008 at 3:32 pm

    Which self-correcting genomic mechanisms are actually prerequisite to maintaining genomic integrity? If memory serves me right, one can disrupt numerous error-correction mechanisms in yeast without actually disrupting the viability of yeast.

    Why not cite the reference? The error correction function is essential. Can it be more efficient in some organisms than in others- yes. Is partial impairment necessarily fatal- perhaps not. Let's take a look at the particulars.

  6. Comment by Bradford — January 13, 2008 @ 3:32 pm

  7. hrun Says:
    January 13th, 2008 at 5:27 pm

    Check out the Saccharomyces Genome Database. You can look at various 'error correction' mutations like rad50. Other examples of 'error correction' mutations for spindle alignment are the mad and bub genes.

    Most of the genes can be deleted without causing inviability. Thus, it appears that they are not prerequisite to maintaining genomic integrity. They may be helpful, but not prerequisite.

  8. Comment by hrun — January 13, 2008 @ 5:27 pm

  9. Bradford Says:
    January 13th, 2008 at 5:36 pm

    Most of the genes can be deleted without causing inviability.

    So their reproductive fitness with respect to others of the same species is impacted in what way?

    Thus, it appears that they are not prerequisite to maintaining genomic integrity. They may be helpful, but not prerequisite.

    The most efficient organism at eliminating genetic mistakes is unicellular. Variation in effectiveness among living organisms exists. I don't know of any cellular organism lacking an error correction capacity. Do you?

  10. Comment by Bradford — January 13, 2008 @ 5:36 pm

  11. hrun Says:
    January 13th, 2008 at 6:17 pm

    The most efficient organism at eliminating genetic mistakes is unicellular. Variation in effectiveness among living organisms exists. I don't know of any cellular organism lacking an error correction capacity. Do you?

    Bradford, you claimed that error correction is a prerequisite for genomic integrity. If I can show you organisms that are viable when error correction mechanisms are disable, would that invalidate your claim?

    So their reproductive fitness with respect to others of the same species is impacted in what way?

    Did you look at the website? It's all there:

    phenotypes of rad50 mutant

  12. Comment by hrun — January 13, 2008 @ 6:17 pm

  13. Bradford Says:
    January 13th, 2008 at 7:49 pm

    Bradford, you claimed that error correction is a prerequisite for genomic integrity. If I can show you organisms that are viable when error correction mechanisms are disable, would that invalidate your claim?

    You did not show that all error correction mechanisms were disabled. Mechanisms are plural.

  14. Comment by Bradford — January 13, 2008 @ 7:49 pm

  15. hrun Says:
    January 13th, 2008 at 9:07 pm

    You did not show that all error correction mechanisms were disabled. Mechanisms are plural.

    No, I have not. But I am challenging your blanket statement that 'error correction is a prerequisite for genomic integrity'. I don't think that you are able to actually support that statement.

    I absolutely agree that error correction is necessary for efficient growth, for the ability to deal with induced DNA damage, … but this does not mean that it is a prerequisite for genome integrity (or life for that matter).

  16. Comment by hrun — January 13, 2008 @ 9:07 pm

  17. Bradford Says:
    January 13th, 2008 at 9:16 pm

    I absolutely agree that error correction is necessary for efficient growth, for the ability to deal with induced DNA damage, "¦ but this does not mean that it is a prerequisite for genome integrity (or life for that matter).

    Things are ultimately settled experimentally but there is much more to genomic repair than RAD 50 and recombination. The minimal genome studies I'm familiar with include at least a partial set of genes whose function involves error correction. If you want to argue that the matter is an open question I have no difficulties with that but would not have many doubts about the consequences to an organism of disabling a laundry list I could supply.

  18. Comment by Bradford — January 13, 2008 @ 9:16 pm

  19. hrun Says:
    January 13th, 2008 at 9:26 pm

    Things are ultimately settled experimentally but there is much more to genomic repair than RAD 50 and recombination. The minimal genome studies I'm familiar with include at least a partial set of genes whose function involves error correction. If you want to argue that the matter is an open question I have no difficulties with that but would not have many doubts about the consequences to an organism of disabling a laundry list I could supply.

    Yes, there is certainly more to it. Yet, until it is actually established that error correction is essential for genomic integrity (or life), maybe it should not be claimed that it actually is.

    For example, I have seen people argue that error correction/DNA repair is another example of IC. For that to be true, one has to show that maintaining a functional genome without error correction/DNA repair is ACTUALLY essential.

  20. Comment by hrun — January 13, 2008 @ 9:26 pm

  21. Bradford Says:
    January 13th, 2008 at 9:34 pm

    For example, I have seen people argue that error correction/DNA repair is another example of IC. For that to be true, one has to show that maintaining a functional genome without error correction/DNA repair is ACTUALLY essential.

    Your confusing a claim for essentiality of function with IC which has to do with function involving multiple components. While all components of a given system may not be essential (sub-optimal function being possible) biological systems do entail interacting parts- at least some of which are needed for known and identifiable functions.

  22. Comment by Bradford — January 13, 2008 @ 9:34 pm

  23. hrun Says:
    January 13th, 2008 at 10:48 pm

    (there was of course a typo in my previous post and 'essential' should have been 'impossible')

    Your confusing a claim for essentiality of function with IC which has to do with function involving multiple components. While all components of a given system may not be essential (sub-optimal function being possible) biological systems do entail interacting parts- at least some of which are needed for known and identifiable functions.

    I'm not confusing things at all, the claim goes like this:

    1) DNA is required to encode DNA repair proteins and the error correction machinery
    2) DNA repair proteins/error correction machinery are essential for the maintenance of a genome

    Take 1) and 2) together and you have an IC system.

  24. Comment by hrun — January 13, 2008 @ 10:48 pm

  25. Bradford Says:
    January 14th, 2008 at 12:49 am

    1) DNA is required to encode DNA repair proteins and the error correction machinery
    2) DNA repair proteins/error correction machinery are essential for the maintenance of a genome

    Take 1) and 2) together and you have an IC system.

    Agreed.

  26. Comment by Bradford — January 14, 2008 @ 12:49 am

  27. hrun Says:
    January 14th, 2008 at 8:53 am

    Agreed.

    So then you agree that as of now that conclusion is actually not valid: We do not know if DNA repair proteins or an active error correction machinery are essential to the maintenance of a genome.

    It is entirely possible that a genome can be maintained, albeit less efficiently, without error correction. And at some later point, the error correction machinery could have made this process more efficient.

  28. Comment by hrun — January 14, 2008 @ 8:53 am

  29. Bradford Says:
    January 14th, 2008 at 3:27 pm

    So then you agree that as of now that conclusion is actually not valid: We do not know if DNA repair proteins or an active error correction machinery are essential to the maintenance of a genome.

    We have very good evidence that correction and error repair are essential. We know the causes of genomic corruption and are aware of the specifcity required for many essential biological functions. We also have an abundance of evidence indicating what occurs when error correction functions are disabled. There are labels attached to the diseases associated with this.

    It is entirely possible that a genome can be maintained, albeit less efficiently, without error correction. And at some later point, the error correction machinery could have made this process more efficient.

    Maintenance entails some form of error correction or control of oxygen radicals and other metabolic by-products that incur damage. The list of damaging causes includes natural and inevitable natural processes like deamination, spontaneous losses and radiation including UV. There is no escaping causes of genetic damage. The problem with the developing at a later point scenario is it assumes new information would be generated faster than genetic information is lost through damaging agents. Testing genomes, stripped of their error correction mechanisms, would offer a means of putting your belief on an empirical basis.

  30. Comment by Bradford — January 14, 2008 @ 3:27 pm

  31. hrun Says:
    January 14th, 2008 at 3:36 pm

    We have very good evidence that correction and error repair are essential.

    Like what?

    We know the causes of genomic corruption and are aware of the specifcity required for many essential biological functions. We also have an abundance of evidence indicating what occurs when error correction functions are disabled. There are labels attached to the diseases associated with this.

    Yes, certain mutations in error correction are associated with human disease. But numerous mutations in error correction show no obvious phenotype at all– and definitely not inviability– in yeast. So this does not lead to the conclusion that error correction is necessary for life as we know it.

    Maintenance entails some form of error correction or control of oxygen radicals and other metabolic by-products that incur damage. The list of damaging causes includes natural and inevitable natural processes like deamination, spontaneous losses and radiation including UV. There is no escaping causes of genetic damage. The problem with the developing at a later point scenario is it assumes new information would be generated faster than genetic information is lost through damaging agents. Testing genomes, stripped of their error correction mechanisms, would offer a means of putting your belief on an empirical basis.

    That's why I say you should check out the phenotypes associated with such mutants. It turns out that numerous of such mutants are viable. I'm just trying to figure out how you are getting to your conclusion that an error correction mechanism is prerequisite for genomic maintenance (and presumably for life in general).

  32. Comment by hrun — January 14, 2008 @ 3:36 pm

  33. Doug Says:
    January 14th, 2008 at 3:50 pm

    It is entirely possible that a genome can be maintained, albeit less efficiently, without error correction. And at some later point, the error correction machinery could have made this process more efficient.

    But the transcription & translation machinery would be a product of this genome which lacks error correction procedures. They would be comprised of proteins & rna that would be less efficient because they too would have no way of correcting the deleterious mutations that would occur in genetic segments that specified those constituent proteins and rna.

    Then the proteins and rna that those transcriptional & translational apparatuses would yield would in turn be less efficient. It seems like the problem just snowballs until a mutational crash would lead to an organism that is corrupted beyond repair.

  34. Comment by Doug — January 14, 2008 @ 3:50 pm

  35. Bradford Says:
    January 14th, 2008 at 3:52 pm

    But numerous mutations in error correction show no obvious phenotype at all"“ and definitely not inviability"“ in yeast.

    You sourced a reference indicating corruption of the recombination mechanism; hardly a disablement of error correction.

    I'm just trying to figure out how you are getting to your conclusion that an error correction mechanism is prerequisite for genomic maintenance (and presumably for life in general).

    Genetic damage is a natural phenomenon. Continued unchecked damage has only one eventual outcome- genomic meltdown.

  36. Comment by Bradford — January 14, 2008 @ 3:52 pm

  37. Doug Says:
    January 14th, 2008 at 4:03 pm

    But numerous mutations in error correction show no obvious phenotype at all"“ and definitely not inviability"“ in yeast.

    I don't see how this helps your position. If it shows no effect at the level of the phenotype than natural selection is unable to even weed out the deleterious mutations. If you would have said that their effects are noticeable at the phenotypic level than at least NS would be able to play some role in limiting these deleterious mutations from getting tossed back into the next reproductive cycle (since NS works at the level of the organism and not the level of a single nucleotide).

    This points back to the problem that Bradford is focusing on. With no internal means to correct deleterious mutations & no way for NS to weed them out (since you stated that their immediate effect won't be noticeable at the level of the phenotype) how does this not lead to an inevitable crash?

  38. Comment by Doug — January 14, 2008 @ 4:03 pm

  39. hrun Says:
    January 14th, 2008 at 4:10 pm

    I don't see how this helps your position. If it shows no effect at the level of the phenotype than natural selection is unable to even weed out the deleterious mutations. If you would have said that their effects are noticeable at the phenotypic level than at least NS would be able to play some role in limiting these deleterious mutations from getting tossed back into the next reproductive cycle (since NS works at the level of the organism and not the level of a single nucleotide).

    This is not about my position. It is merely about the claim that error correction is a PREREQUISITE (or necessary) for genomic integrity (or life in general). That's the only thing I'm arguing about.

    This points back to the problem that Bradford is focusing on. With no internal means to correct deleterious mutations & no way for NS to weed them out (since you stated that their immediate effect won't be noticeable at the level of the phenotype) how does this not lead to an inevitable crash?

    Because the organisms with the error correction a) often grow faster than their mutant counterparts and b) in case they are exposed to larger doses of DNA damaging agents the organisms without error correction may die while the others don't.

    But, bear in mind, that neither a) nor b) allows you to conclude that life is impossible without error correction.

  40. Comment by hrun — January 14, 2008 @ 4:10 pm

  41. Bradford Says:
    January 14th, 2008 at 4:15 pm

    But, bear in mind, that neither a) nor b) allows you to conclude that life is impossible without error correction.

    There is much more evidence for that position than the frequently argued one that genomes self-assembled through an unknown chemical process. ID critics have a way of raising and lowering the evidentiary bar to suit their ideological preferences.

  42. Comment by Bradford — January 14, 2008 @ 4:15 pm

  43. hrun Says:
    January 14th, 2008 at 4:28 pm

    There is much more evidence for that position than the frequently argued one that genomes self-assembled through an unknown chemical process. ID critics have a way of raising and lowering the evidentiary bar to suit their ideological preferences.

    So the support for you position is that there are other scientific positions that have even worse evidentiary support?

    And I asked you before: What is that evidence that supposedly supports your assertion? I have just scanned back through our discussion here, and I have not found any evidence to support the assertion that error correction is a prerequisite for life.

  44. Comment by hrun — January 14, 2008 @ 4:28 pm

  45. Raevmo Says:
    January 14th, 2008 at 4:36 pm

    Doug:

    I don't see how this helps your position. If it shows no effect at the level of the phenotype than natural selection is unable to even weed out the deleterious mutations.

    This doesn't make sense. A mutation is deleterious by definition if it induces a phenotype of lower fitness. Hence a mutation without a phenotypic effect cannot be deleterious.

  46. Comment by Raevmo — January 14, 2008 @ 4:36 pm

  47. Bradford Says:
    January 14th, 2008 at 4:36 pm

    And I asked you before: What is that evidence that supposedly supports your assertion? I have just scanned back through our discussion here, and I have not found any evidence to support the assertion that error correction is a prerequisite for life.

    hrun, if you are ignorant of error repair mechanisms take a good textbook on biochemistry or genetics and study it. If your problem is lack of knowledge as to effects of disabling key enzymes involved in repair pathways then look up related diseases. If you cannot substract unremedied damage to genomes and figure out zero function is the ultimate result noone can help you. To claim there is no evidence is weaker than claiming no evidence for evolution. The claims and counter claims are testable.

  48. Comment by Bradford — January 14, 2008 @ 4:36 pm

  49. Doug Says:
    January 14th, 2008 at 4:38 pm

    This is not about my position. It is merely about the claim that error correction is a PREREQUISITE (or necessary) for genomic integrity (or life in general). That's the only thing I'm arguing about.

    But isn't it at least a prerequisite for genomic integrity? I might be confused with the point your making, but how else is genomic integrity to be maintained if not via error correction mechanisms? And if the effects of these deleterious mutations are not having an immediate impact at the level of the phenotype. Unless you and I are understanding 'genomic integrity' differently.

    Because the organisms with the error correction a) often grow faster than their mutant counterparts and b) in case they are exposed to larger doses of DNA damaging agents the organisms without error correction may die while the others don't.

    I agree, they will die more rapidly while the others won't - but you've still got accumulating mutations at the genetic level. Initially those effects might be obscured from the level of the whole organism, allowing reproductive success (compared to those with no success). But these mutations are just getting passed on to the next generation. You've got inherited mutations accruing along with new mutations occuring.

  50. Comment by Doug — January 14, 2008 @ 4:38 pm

  51. Raevmo Says:
    January 14th, 2008 at 4:43 pm

    This paper (Kun et al 2005, Nature Genetics 37) suggests that mutation rates may be small enough to counter Eigen's paradox:

    The error threshold for replication, the critical copying fidelity below which the fittest genotype deterministically disappears, limits the length of the genome that can be maintained by selection. Primordial replication must have been error-prone, and so early replicators are thought to have been necessarily short1. The error threshold also depends on the fitness landscape. In an RNA world2, many neutral and compensatory mutations can raise the threshold, below which the functional phenotype3, rather than a particular sequence, is still present4,5. Here we show, on the basis of comparative analysis of two extensively mutagenized ribozymes, that with a copying fidelity of 0.999 per digit per replication the phenotypic error threshold rises well above 7,000 nucleotides, which permits the selective maintenance of a functionally rich riboorganism6 with a genome of more than 100 different genes, the size of a
    tRNA. This requires an order of magnitude of improvement in
    the accuracy of in vitro"“generated polymerase ribozymes7,8.
    Incidentally, this genome size coincides with that estimated
    for a minimal cell achieved by top-down analysis9, omitting
    the genes dealing with translation.

  52. Comment by Raevmo — January 14, 2008 @ 4:43 pm

  53. hrun Says:
    January 14th, 2008 at 4:49 pm

    hrun, if you are ignorant of error repair mechanisms take a good textbook on biochemistry or genetics and study it. If your problem is lack of knowledge as to effects of disabling key enzymes involved in repair pathways then look up related diseases. If you cannot substract unremedied damage to genomes and figure out zero function is the ultimate result noone can help you. To claim there is no evidence is weaker than claiming no evidence for evolution. The claims and counter claims are testable.

    Excellent. I asked for evidence to support your position. First we get numerous posts without any evidence. Then you cite in your support that other positions are even less supported. Finally you accuse me of ignorance.

    I don't have any lack of knowledge about repair pathways. That's why I knew that you can disable numerous players in the repairs pathways of yeast without actually inducing lethality in yeast.

    Finally, your argument about 'zero function being the ultimate result' is also not self evident. In order to show that, you have to show that the rate of deleterious mutations is high in comparison to the reproduction rate of the organism in question. For example, if an organism accumulates only a single critically deleterious mutation in the time it takes it to divide, then the population level will be static (all other sources of mortality disregarded). If the reproduction rate exceeds the rate of critically deleterious mutations, then the organisms will persists without any error correction machinery.

    Now, again, do you have any evidence to support your position, other than that certain positions have less support or that I am ignorant?

  54. Comment by hrun — January 14, 2008 @ 4:49 pm

  55. hrun Says:
    January 14th, 2008 at 4:52 pm

    But isn't it at least a prerequisite for genomic integrity? I might be confused with the point your making, but how else is genomic integrity to be maintained if not via error correction mechanisms? And if the effects of these deleterious mutations are not having an immediate impact at the level of the phenotype. Unless you and I are understanding 'genomic integrity' differently.

    Doug, see my previous post to Bradford. In order to be necessary for genomic integrity, the frequence of critically deleterious mutations has to be higher than the reproduction rate of the organism. Simple as that.

  56. Comment by hrun — January 14, 2008 @ 4:52 pm

  57. Bradford Says:
    January 14th, 2008 at 5:19 pm

    I don't have any lack of knowledge about repair pathways. That's why I knew that you can disable numerous players in the repairs pathways of yeast without actually inducing lethality in yeast.

    Then maybe you are ignorant of the significance of citing mutations affecting a function -recombination- and thinking you have made a point about error repair that extends beyond recombination.

    Finally, your argument about 'zero function being the ultimate result' is also not self evident. In order to show that, you have to show that the rate of deleterious mutations is high in comparison to the reproduction rate of the organism in question. For example, if an organism accumulates only a single critically deleterious mutation in the time it takes it to divide, then the population level will be static (all other sources of mortality disregarded). If the reproduction rate exceeds the rate of critically deleterious mutations, then the organisms will persists without any error correction machinery.

    Your analysis is flawed. The unchecked mutations would affect every organism of the species. The reproductive fitness of that species would steadily decline. Extinction is the logical prediction.

  58. Comment by Bradford — January 14, 2008 @ 5:19 pm

  59. hrun Says:
    January 14th, 2008 at 5:30 pm

    Then maybe you are ignorant of the significance of citing mutations affecting a function -recombination- and thinking you have made a point about error repair that extends beyond recombination.

    Bradford, again, I ask, what is your evidence?

    Your analysis is flawed. The unchecked mutations would affect every organism of the species. The reproductive fitness of that species would steadily decline. Extinction is the logical prediction.

    Huh? The unchecked mutations would only affect the progeny of the organism that got the mutation in the first place, not the entire species. And what is your evidence that the reproductive fitness of that species would steadily decline? You have none.

    Let's do a simple thought experiment, ok? Let's assume that organism X accumulates a single point mutation every day and let's assume that this organism can divide every hour. Let's finally assume that organism X does not have any DNA repair or error correction machinery.

    What do you think? Is the genome of said organism stable or will extinction be the logical prediction?

    Granted there is no such organism X. In fact the mutation rate will probably be higher, but how much higher? So, extinction is only the logical prediction if the mutation rate is sufficiently high in relation to the reproductive rate of the organism.

  60. Comment by hrun — January 14, 2008 @ 5:30 pm

  61. Raevmo Says:
    January 14th, 2008 at 5:32 pm

    Bradford:

    Your analysis is flawed. The unchecked mutations would affect every organism of the species. The reproductive fitness of that species would steadily decline. Extinction is the logical prediction.

    Bullshit. Have you ever examined a mathematical model for the error threshold? Whether mutational meltdown occurs or not depends on mutation rate, selection differentials and genome size. It's not a done deal without error correction.

  62. Comment by Raevmo — January 14, 2008 @ 5:32 pm

  63. Bradford Says:
    January 14th, 2008 at 5:38 pm

    Huh? The unchecked mutations would only affect the progeny of the organism that got the mutation in the first place, not the entire species. And what is your evidence that the reproductive fitness of that species would steadily decline? You have none.

    During the time it takes you to read this comment dozens of genetic errors will be repaired in your body. It is a constant process that never stops. If the corrections were not made death would result and would not take long for that matter. What do you think the cause of death is from radiation poisoning- the type found at Hiroshima or Nagasaki or Chernobyl? It is the complete and unremedied destruction of DNA. The errors overwhelm repair capacity. The only diffference between these catastrophic scenarios and the stripped genomes is one of time. It would take longer to cripple genomes stripped of repair capacities.

  64. Comment by Bradford — January 14, 2008 @ 5:38 pm

  65. Bradford Says:
    January 14th, 2008 at 5:41 pm

    Whether mutational meltdown occurs or not depends on mutation rate, selection differentials and genome size. It's not a done deal without error correction.

    Mutations rates are over the top when no repair mechanisms exist. The mutation ranges we see are limited by error repair. Take error repair away and the rate skyrockets.

  66. Comment by Bradford — January 14, 2008 @ 5:41 pm

  67. hrun Says:
    January 14th, 2008 at 5:47 pm

    During the time it takes you to read this comment dozens of genetic errors will be repaired in your body. It is a constant process that never stops. If the corrections were not made death would result and would not take long for that matter. What do you think the cause of death is from radiation poisoning- the type found at Hiroshima or Nagasaki or Chernobyl? It is the complete and unremedied destruction of DNA. The errors overwhelm a a repair capacity. The only diffference between these catastrophic scenarios and the stripped genomes is one of time. It would take longer to cripple genomes stripped of repair capacities.

    Since we have about 10 trillion cells in our body, the number of mutations that are being repaired in my body during this time is undoubtedly MUCH higher than just a few dozen.

    And again you are refusing to engage into the actual point of contention. I do not claim that no mutations occur in the human body. I do not claim that error correction in the human body is unimportant. I do not claim that an organism without error correction functions equally good as an organism with error correction.

    I solely challenge you to support the notion that DNA repair or error correction is prerequisite or necessary for life. And you have again failed to give any support to your assertion.

    Mutations rates are over the top when no repair mechanisms exist. The mutation ranges we see are limited by error repair. Take error repair away and the rate skyrockets.

    Really, and you know that how? If mutation rates skyrocket if you take away error repair, why are so many yeast mutations in the error repair pathways viable?

  68. Comment by hrun — January 14, 2008 @ 5:47 pm

  69. Bradford Says:
    January 14th, 2008 at 5:57 pm

    I solely challenge you to support the notion that DNA repair or error correction is prerequisite or necessary for life. And you have again failed to give any support to your assertion.

    I've repeatedly said that my claims as well as your counter claims are testable. Researchers involved in minimal genome studies have indirectly tested the claim. Such genomes include at least a partial set of genes whose function entails error correction.

  70. Comment by Bradford — January 14, 2008 @ 5:57 pm

  71. Bradford Says:
    January 14th, 2008 at 5:58 pm

    Really, and you know that how? If mutation rates skyrocket if you take away error repair, why are so many yeast mutations in the error repair pathways viable?

    How many error mechanisms other than recombination can you cite?

  72. Comment by Bradford — January 14, 2008 @ 5:58 pm

  73. Raevmo Says:
    January 14th, 2008 at 6:02 pm

    Bradford:

    Mutations rates are over the top when no repair mechanisms exist. The mutation ranges we see are limited by error repair. Take error repair away and the rate skyrockets.

    You make quantitative claims without showing any calculations or references. Why should we believe you? I have shown you a paper that shows that mutation rates in some ribozymes are sufficiently small to overcome the error threshold (which can be calculated according to ancient models by Eigen and Schuster), meaning that without error correction genomes of substantial sizes can persist in mutation-selection balance. What is your quantitative counter-argument?

  74. Comment by Raevmo — January 14, 2008 @ 6:02 pm

  75. Bradford Says:
    January 14th, 2008 at 6:04 pm

    I have shown you a paper that shows that mutation rates in some ribozymes are sufficiently small to overcome the error threshold (which can be calculated according to ancient models by Eigen and Schuster), meaning that without error correction genomes of substantial sizes can persist in mutation-selection balance. What is your quantitative counter-argument?

    What is synthesized as a consequence of the expression of this "ribozyme genome?"

  76. Comment by Bradford — January 14, 2008 @ 6:04 pm

  77. hrun Says:
    January 14th, 2008 at 6:13 pm

    How many error mechanisms other than recombination can you cite?

    Why should I bother? You don't seem willing to engage in an actual argument anyway… Otherwise you would have know that I already cited two additional error correction mechanisms, namely the spindle assembly checkpoint and the spindle orientation checkpoint.

    But we can look at others as well if you like. Double strand break repair, excision repair, UV repair…

    So, did I cite a sufficient number for you? Now can you actually engage in the argument? I ask this again: what evidence do you have to support your assertion (other than simply saying 'Take error repair away and the rate skyrockets')?

  78. Comment by hrun — January 14, 2008 @ 6:13 pm

  79. Bradford Says:
    January 14th, 2008 at 6:20 pm

    So, did I cite a sufficient number for you? Now can you actually engage in the argument? I ask this again: what evidence do you have to support your assertion (other than simply saying 'Take error repair away and the rate skyrockets')?

    Since you are repeating yourself I'll return the favor. The claims and counter claims are testable. The results are distinguishable from an argument. One thing you have amply illustrated with your arguments is the scientific nature of ID arguments. They can be tested.

  80. Comment by Bradford — January 14, 2008 @ 6:20 pm

  81. Raevmo Says:
    January 14th, 2008 at 6:23 pm

    Bradford:

    What is synthesized as a consequence of the expression of this "ribozyme genome?"

    What difference does that make? I recommend reading the paper. I can email it if you don't have access.

  82. Comment by Raevmo — January 14, 2008 @ 6:23 pm

  83. Bradford Says:
    January 14th, 2008 at 6:27 pm

    What is synthesized as a consequence of the expression of this "ribozyme genome?"

    Raevmo: What difference does that make?

    The difference lies in the difference between an enzyme and a genome. Minimal sizes of the latter include hundreds of genes. Function and dynamics differ. A minimally functional genome is a better testing candidate.

  84. Comment by Bradford — January 14, 2008 @ 6:27 pm

  85. Bradford Says:
    January 14th, 2008 at 6:43 pm

    Mike Gene is the premier front loading advocate, not me. However, it appears that error correction function claims amount to a claim related to front loading of specific mechanisms. The claim can be linked to specific stages of development. At what point does error correction become a necessity? The outset? Later? When?

  86. Comment by Bradford — January 14, 2008 @ 6:43 pm

  87. hrun Says:
    January 14th, 2008 at 6:45 pm

    Since you are repeating yourself I'll return the favor. The claims and counter claims are testable. The results are distinguishable from an argument. One thing you have amply illustrated with your arguments is the scientific nature of ID arguments. They can be tested.

    ?

    First: I have asked numerous times for support for your assertion. I am keenly aware that your assertion is testable. You just don't provide any support for your assertion. I really don't exactly know why you fail to do so. One can only suspect that you actually do not have such evidence to present.

    Second: I know that results are distinguishable from arguments. That's why I actually link to sites that show that mutants in error correction are viable and that contrary to your assertion, the mere inactivation of certain error correction pathways does not lead to inviability (or skyrocketing mutation rates). I have also shown by a simple thought experiment that your assertion 'Extinction is the logical prediction.' is simply and plainly false.

    Third: I have not shown that 'ID arguments' are scientific. I have shown that you can not support your assertion with evidence. Your assertion, btw. is not necessarily an 'ID argument'. Even if organisms are designed, error correction does not have to be a prerequisite for life. So every single organism on this planet could be directly designed by a biochemist or by a deity, yet, your assertion still could just as well be false.

    Fourth: I knew I shouldn't have bothered with citing more error repair mechanisms. You asked how many I could cite, I cite more, you ignore it. Why do you even ask?

  88. Comment by hrun — January 14, 2008 @ 6:45 pm

  89. Raevmo Says:
    January 14th, 2008 at 6:49 pm

    Bradford:

    The difference lies in the difference between an enzyme and a genome. Minimal sizes of the latter include hundreds of genes. Function and dynamics differ. A minimally functional genome is a better testing candidate.

    Please. Here's once again from the abstract I quoted:

    Incidentally, this genome size coincides with that estimated for a minimal cell achieved by top-down analysis

    Your argument has been shredded. You do not respond to the quantitative challenges to your unfounded claims. Game over.

  90. Comment by Raevmo — January 14, 2008 @ 6:49 pm

  91. Doug Says:
    January 14th, 2008 at 6:51 pm

    Doug, see my previous post to Bradford. In order to be necessary for genomic integrity, the frequence of critically deleterious mutations has to be higher than the reproduction rate of the organism. Simple as that.

    Genomic integrity is compromised whenever a deleterious mutation occurs; the issue would be the reach and extent of that compromise.
    But focusing primarily on 'critically deleterious mutations' doesn't seem right. Because if those mutations go unchecked and if no mechanism is in place to prevent their accumulation, it doesn't appear to be an issue of the occurrence of one mutation being criticially deleterious but that of a net accumulation which would be critically deleterious.

    But what is the frequency of mutations? If you look at a human genome the average offspring has about 280 mutational variations from his/her parents - and that's with all of the corrective machinery. Also, that number could be on the low end of actual mutational variations - the numbers reflect mathematical scenarios not necessarily the actual mutation rate.

  92. Comment by Doug — January 14, 2008 @ 6:51 pm

  93. Doug Says:
    January 14th, 2008 at 6:52 pm

    Your argument has been shredded. You do not respond to the quantitative challenges to your unfounded claims. Game over.

    I'd ignore the taunt, Bradford…. probably just those monkey genes kicking in again.

  94. Comment by Doug — January 14, 2008 @ 6:52 pm

  95. Bradford Says:
    January 14th, 2008 at 6:57 pm

    First: I have asked numerous times for support for your assertion. I am keenly aware that your assertion is testable. You just don't provide any support for your assertion. I really don't exactly know why you fail to do so. One can only suspect that you actually do not have such evidence to present.

    It would not matter what evidence I presented. You have a closed mind that is threatened by the issue. Continued and unmitigated destruction to genomes has only one end result. The reproduction argument is a fallacy. All members of a species would experience degradation and continual decline of fitness. Selection would amount to the selection of the less and less fit as time goes on. Spell extinction

    Second: I know that results are distinguishable from arguments. That's why I actually link to sites that show that mutants in error correction are viable and that contrary to your assertion,

    You're misrepresenting my claim. I never claimed a partial impairment of genomic integrity is necessarily fatal. My claims are global with respect to repair functions. Knock them all out and watch the steady and continous decline in reproductive fitness.

    Third: I have not shown that 'ID arguments' are scientific. I have shown that you can not support your assertion with evidence. Your assertion, btw. is not necessarily an 'ID argument'. Even if organisms are designed, error correction does not have to be a prerequisite for life.

    If genomic function fails in the absence of error correction then you can argue for a natural miracle in lieu of design.:wink:

  96. Comment by Bradford — January 14, 2008 @ 6:57 pm

  97. Bradford Says:
    January 14th, 2008 at 6:58 pm

    Raevmo, don't you teach how to distinguish an enzyme from a genome?

  98. Comment by Bradford — January 14, 2008 @ 6:58 pm

  99. Raevmo Says:
    January 14th, 2008 at 7:02 pm

    Doug:

    But focusing primarily on 'critically deleterious mutations' doesn't seem right. Because if those mutations go unchecked and if no mechanism is in place to prevent their accumulation, it doesn't appear to be an issue of the occurrence of one mutation being criticially[sic] deleterious but that of a net accumulation which would be critically deleterious.

    I noticed you didn't respond to my devastating critique of your previous post. If you don't know what you're talking about, it's better to shut up, to paraphrase a famous Austrian philosopher.
    Biology has become a very quantitative science as of lately. Gut-feeling arguments just don't cut it anymore.

  100. Comment by Raevmo — January 14, 2008 @ 7:02 pm

  101. hrun Says:
    January 14th, 2008 at 7:04 pm

    I'd ignore the taunt, Bradford"¦. probably just those monkey genes kicking in again.

    Ignore the taunt if you like, but please, finally engage in the arguments made.

    Genomic integrity is compromised whenever a deleterious mutation occurs; the issue would be the reach and extent of that compromise.

    Exactly. You are actually engaging in the argument that this is a quantitative problem. The deleterious mutations have to occur at a high enough rate as to overwhelm reproduction.

    But focusing primarily on 'critically deleterious mutations' doesn't seem right. Because if those mutations go unchecked and if no mechanism is in place to prevent their accumulation, it doesn't appear to be an issue of the occurrence of one mutation being criticially deleterious but that of a net accumulation which would be critically deleterious.

    Again, you are actually engaging in the argument. You are absolutely right in this case. So now one has to show (in order to prove that error correction is necessary for life) that this deleterious mutations accumulate at a sufficiently high rate.

    But what is the frequency of mutations? If you look at a human genome the average offspring has about 280 mutational variations from his/her parents - and that's with all of the corrective machinery. Also, that number could be on the low end of actual mutational variations - the numbers reflect mathematical scenarios not necessarily the actual mutation rate.

    Ok. So humans have a genome size of about 3×10E9 while E. coli has a genome size of only 5×10E6. So 280 mutational variations in every 3×10E9 basepairs would amount to only numerous completely flawless E. coli copies.

    So mathematically, the mutation rate can actually be higher and still there would be plenty of flawless copies of E. coli around.

  102. Comment by hrun — January 14, 2008 @ 7:04 pm

  103. hrun Says:
    January 14th, 2008 at 7:10 pm

    It would not matter what evidence I presented [...]

    Sigh. As I thought. You ignored the taunt AND completely failed to engage in the argument. Again.

    But hey, now we have a new line of argument from you. Let's list it chronologically:

    1) numerous posts without a single argument
    2) other positions have even less support than your assertion
    3) I am ignorant
    4) I have a closed mind

    I wonder what would be next.

  104. Comment by hrun — January 14, 2008 @ 7:10 pm

  105. Raevmo Says:
    January 14th, 2008 at 7:17 pm

    Bradford:

    Raevmo, don't you teach how to distinguish an enzyme from a genome?

    No I don't. All I teach freshmen biologists is statistics. More advanced biology and modeling for older students. But I hope you do realize that the earliest genomes might very well have been self-replicating enzymes. Oh, and you still didn't respond to my quantitative challenges to your claims about repair mechanisms.

  106. Comment by Raevmo — January 14, 2008 @ 7:17 pm

  107. Bradford Says:
    January 14th, 2008 at 7:38 pm

    Sigh. As I thought. You ignored the taunt AND completely failed to engage in the argument. Again.

    Hrun, why have you ignored repeated references to minimal genome research that includes, within the minimal number, error repair genes. If error correction was superfluous then one would expect minimal genomes to exclude the related genes.

  108. Comment by Bradford — January 14, 2008 @ 7:38 pm

  109. Bradford Says:
    January 14th, 2008 at 7:43 pm

    But I hope you do realize that the earliest genomes might very well have been self-replicating enzymes.

    :lol: After being accused of not producing evidence is this the model for it? Earliest genomes might have been SRMs? Why do you refer to an SRM as a genome? Both have nucleotides. Is that the answer?

  110. Comment by Bradford — January 14, 2008 @ 7:43 pm

  111. Bradford Says:
    January 14th, 2008 at 7:53 pm

    Doug:

    But what is the frequency of mutations? If you look at a human genome the average offspring has about 280 mutational variations from his/her parents - and that's with all of the corrective machinery. Also, that number could be on the low end of actual mutational variations - the numbers reflect mathematical scenarios not necessarily the actual mutation rate.

    The mutation rate is a small fraction of what it would be without error correction. Global affliction increases the fatality rate for the species. Also increasing would be the amount of mildly deleterious mutations that can be tolerated only to a point. I don't know of anyone other than hrun who thinks error correction is a superfluous function.

  112. Comment by Bradford — January 14, 2008 @ 7:53 pm

  113. Raevmo Says:
    January 14th, 2008 at 8:01 pm

    Bradford:

    After being accused of not producing evidence is this the model for it?

    You have not produced a shred of evidence for your position, which has been demolished by quantitative counter-arguments which you refuse to answer. Now you mock my suggestion for an explicit model, that which you have so far refused to posit. What's wrong with you, man?

  114. Comment by Raevmo — January 14, 2008 @ 8:01 pm

  115. Raevmo Says:
    January 14th, 2008 at 8:05 pm

    Bradford:

    The mutation rate is a small fraction of what it would be without error correction. Global affliction increases the fatality rate for the species.

    What is your evidence for these quantitative claims? I think you're just making this up. Are you full of shit or can you back up your claims?

  116. Comment by Raevmo — January 14, 2008 @ 8:05 pm

  117. Bradford Says:
    January 14th, 2008 at 8:22 pm

    You have not produced a shred of evidence for your position, which has been demolished by quantitative counter-arguments which you refuse to answer. Now you mock my suggestion for an explicit model, that which you have so far refused to posit.

    Why have you ignored repeated references to minimal genome research that includes, within the minimal number, error repair genes. If error correction was superfluous then one would expect minimal genomes to exclude the related genes.

  118. Comment by Bradford — January 14, 2008 @ 8:22 pm

  119. Raevmo Says:
    January 14th, 2008 at 8:33 pm

    Bradford:

    Why have you ignored repeated references to minimal genome research that includes, within the minimal number, error repair genes. If error correction was superfluous then one would expect minimal genomes to exclude the related genes.

    For the third time, I quote from the Nature Genetics article:

    Incidentally, this genome size coincides with that estimated for a minimal cell achieved by top-down analysis

    Meaning that minimal genomes can do without error repair, contra your claim.

    Unless you have scientific evidence to the contrary, can we now finally agree that you might have been wrong in claiming that error correction is essential?

  120. Comment by Raevmo — January 14, 2008 @ 8:33 pm

  121. Bradford Says:
    January 14th, 2008 at 8:44 pm

    Unless you have scientific evidence to the contrary, can we now finally agree that you might have been wrong in claiming that error correction is essential?

    There is a distinction between essential and minimal. There is also the matter of how long an organism can remain viable. Loss of total error correction capacity would result in a steady degeneration of a genome would you agree?

  122. Comment by Bradford — January 14, 2008 @ 8:44 pm

  123. Raevmo Says:
    January 14th, 2008 at 8:59 pm

    Bradford:

    There is a distinction between essential and minimal. There is also the matter of how long an organism can remain viable. Loss of total error correction capacity would result in a steady degeneration of a genome would you agree?

    No I would not. Nor would you, had you looked up the mathematical models that calculate the probability that this would happen. It's very simple: if the mutation rate is small enough, and if the negative fitness effect of a mutation is small enough, then a population can persist without error correction. That's a mathematical fact. The question is if these conditions would hold for actual populations of simple genomes. Well, the paper I cited suggests that they do. If you want to object to these findings, you had better come up with some solid quantitative arguments. Otherwise, we're entitled to conclude that you're just bluffing.

  124. Comment by Raevmo — January 14, 2008 @ 8:59 pm

  125. Bradford Says:
    January 14th, 2008 at 9:18 pm

    No I would not. Nor would you, had you looked up the mathematical models that calculate the probability that this would happen. It's very simple: if the mutation rate is small enough, and if the negative fitness effect of a mutation is small enough, then a population can persist without error correction.

    Your belief that the mutation rate of a correctionless genome would be small enough is based on what?

    That's a mathematical fact. The question is if these conditions would hold for actual populations of simple genomes. Well, the paper I cited suggests that they do.

    I have a problem taking seriously the suggestion that self-replicators of an RNA world constitute a genome. The distinguishing feature of genomes is not their link to nucleic acids, it is the function of codons within them. They are symbolic. Enzymatic NRs are not. It makes no sense to ruminate about genomic integry when the "genome" lacks even a convention by which the order of its nucleotides can be understood. If a change occurs in a ribozyme and I ask on what basis is selection evaluated what is your answer? Will the change be retained assuming a continuous reaction and be evident on future SRMs? How does that get us closer to a cell?

  126. Comment by Bradford — January 14, 2008 @ 9:18 pm

  127. Raevmo Says:
    January 14th, 2008 at 9:34 pm

    Bradford:

    Your belief that the mutation rate of a correctionless genome would be small enough is based on what?

    For the fourth time I refer to the Nature Genetics paper I cited. Would you please read it?

    I have a problem taking seriously the suggestion that self-replicators of an RNA world constitute a genome. The distinguishing feature of genomes is not their link to nucleic acids, it is the function of codons within them. They are symbolic.

    No, you have a problem taking seriously actual evidence. Your bizarre definition of a genome is completely irrelevant. Well, I am going to sleep now. I hope you come to your senses.

  128. Comment by Raevmo — January 14, 2008 @ 9:34 pm

  129. Bradford Says:
    January 14th, 2008 at 9:52 pm

    Raevmo, I asked:

    It makes no sense to ruminate about genomic integry when the "genome" lacks even a convention by which the order of its nucleotides can be understood. If a change occurs in a ribozyme and I ask on what basis is selection evaluated what is your answer? Will the change be retained assuming a continuous reaction and be evident on future SRMs? How does that get us closer to a cell?

    You refer me to a paper the first sentence of which states:

    The error threshold for replication, the critical copying fidelity below which the fittest genotype deterministically disappears, limits the length of the genome that can be maintained by selection.

    Again I ask you what is the fittest genotype? How is one ribozyme more fit than another in an extracellular world? Why would nature favor the continuity of a reaction of self-replicating molecules? It is your conception of how life must have arisen that is driving your analysis of selection.

  130. Comment by Bradford — January 14, 2008 @ 9:52 pm

  131. gore Says:
    January 14th, 2008 at 11:41 pm

    A few random comments…. First I will add to the debate and just say it wouldn't hurt if bradford gave a refrence to shut them up! I think they are worthy apponents to spend 10 minutes to find an article that supports your claims (I do agree with what you have been saying btw bradford). Anyhow, I just wanted to say thanks to Mike Gene, I just got the book today and in the midst of doing homework (on the first day back) it was a pleasure to read what I wanted to be the first page of the introduction, which turned into reading all five pages. Mike is a great writer! Ok, now I have to get back to homework, keep up the good debate guys!

  132. Comment by gore — January 14, 2008 @ 11:41 pm

  133. valerie Says:
    January 15th, 2008 at 4:48 am

    Bradford,

    Why won't you engage the arguments presented by hrun and Raevmo? It's almost as if you think that evasion is tantamount to victory. It's not. We can all see you running away from the questions.

    You're doing the same thing on the Dembski thread, where I've raised a set of issues that you refuse to address.

    Loss of total error correction capacity would result in a steady degeneration of a genome would you agree?

    Here's a way of looking at things that might reduce your confusion:

    Every population fights a constant battle against mutations. Mutations are inexorable, and if the deleterious ones are not removed from the population they will accumulate, eventually rendering the population extinct.

    How are mutations removed from a population? One way, as you keep telling us, is via error correction mechanisms. If an error is successfully corrected, it is as if the error had never happened in the first place.

    But here's the crucial point: error correction mechanisms are not the only way deleterious mutations are removed from a population. Natural selection also does the job. Organisms having a deleterious mutation tend to be outcompeted by those that do not, and they die off, taking the mutation with them.

    For a population to remain viable, it must prevent deleterious mutations from accumulating. But it can eliminate them either via error correction or natural selection. As long as the total rate of removal balances the rate of introduction, the population remains viable.

    Note that this remains true even if rate of error correction is zero (i.e. no error correction at all). As long as natural selection by itself can keep up with the rate at which deleterious mutations are introduced, the population will survive.

    The lesson: error correction is not inherently essential, only contingently so. If the mutation rate and the size of the genome are low enough, natural selection by itself will maintain a viable population.

    If you claim otherwise, it is up to you to provide a quantitative argument. Raevmos has repeatedly requested this from you, but this appears to be a request you'd rather evade.

  134. Comment by valerie — January 15, 2008 @ 4:48 am

  135. Bradford Says:
    January 15th, 2008 at 6:58 am

    gore writes:

    A few random comments"¦. First I will add to the debate and just say it wouldn't hurt if bradford gave a reference to shut them up! I think they are worthy apponents to spend 10 minutes to find an article that supports your claims (I do agree with what you have been saying btw bradford).

    Raevmo had written:

    It's very simple: if the mutation rate is small enough, and if the negative fitness effect of a mutation is small enough, then a population can persist without error correction.

    And Valerie parrots:

    The lesson: error correction is not inherently essential, only contingently so. If the mutation rate and the size of the genome are low enough, natural selection by itself will maintain a viable population.

    (From Molecular Biology of the Cell, (Alberts, Johnson, Lewis, Raff, Roberts, Walter) The rate of mutation is about the same for most organisms including those as different as bacteria and humans. Each time DNA is replicated this is about a change in one nucleotide per 10^9 nucleotides (page238). On the preceeding page (237) there is a heading entitled Low Mutation rates Are Necessary for Life as We Know It. There is this highly interesting first paragraph:

    Since so many mutations are deleterious no species can afford to allow them to accumulate at a high rate in its germ cells. Although the observed mutation frequency is low, it is nevertheless thought to limit the number of essential proteins that any organism can encode to perhaps 60,000. By an extension of the same argument, a mutation frequency tenfold higher would limit an organism to about 6000 essential genes. In this case, evolution would probably have stopped at an organism less complex than a fruit fly.

    Talk about front loading! Our biological enablement (in terms of DNA repair and the number of essential proteins) was evident already in unicellular genomes. But there is more. Is it tenfold?

    Each of us was born with at least 350 new mutations that make our DNA different from that of our parents.

    Our model bacterium is Esherichia coli the common, and mostly benign, intestinal bacterium. The entire genome was sequenced in 1997 (Blattner et al., 1997) and its size is 4,200,000 base pairs (4.2 × 106 bp). Every time a bacterium divides this amount of DNA has to be replicated; that's 8,400,000 nucleotides (8.4 × 106).

    The most common source of mutation is due to mistakes made during DNA replication when an incorrect nucleotide is incorporated into newly synthesized DNA. The mutation rate due to errors made by the DNA polymerase III replisome is one error for every one hundred million bases (nucleotides) that are incorporated into DNA. This is an error rate of 1/100,000,000, commonly written as 10-8 in exponential notation. Technically, these aren't mutations; they count as DNA damage until the problem with mismatched bases in the double-stranded DNA has been resolved. The DNA repair mechanism fixes 99% of this damage but 1% escapes repair and becomes a mutation. The error rate of repair is 10-2 so the overall error rate during DNA replication is 10-10 nucleotides per replication (10-8 × 10-2) (Tago et al., 2005).

    Underscoring the front loading point there is this:

    GENOME stability is continually challenged by a diverse array of mutagenic forces that include errors during DNA replication, environmental factors such as UV radiation, and endogenous mutagens such as oxygen free radicals generated during oxidative metabolism (LINDAHL 1993). Multiple DNA repair pathways have evolved to minimize the mutagenic consequences of DNA damage and erroneous DNA replication. Most of the major DNA repair pathways have been detected in all three domains of life, suggesting ancient origins.

    Then there is this caveat.

    And finally if you want to see a ribozyme click here.

  136. Comment by Bradford — January 15, 2008 @ 6:58 am

  137. Raevmo Says:
    January 15th, 2008 at 7:40 am

    Bradford, quoting from good old Alberts et al:

    Although the observed mutation frequency is low, it is nevertheless thought to limit the number of essential proteins that any organism can encode to perhaps 60,000. By an extension of the same argument, a mutation frequency tenfold higher would limit an organism to about 6000 essential genes.

    I don't know how Alberts et al. arrive at these numbers (my girlfriend stole my Alberts so I can't check), but let's suppose they are correct. Then by extending the argument even further, a mutation frequency hundredfold higher would limit an organism to about 600 essential genes. Since DNA error repair removes 99% of replication errors, an organism without error repair could have at most 600 genes. The smallest known genome of extant organisms is smaller than that. Hence, life can be sustained without error correction. QED.

  138. Comment by Raevmo — January 15, 2008 @ 7:40 am

  139. gore Says:
    January 15th, 2008 at 10:16 am

    good job bradford, I knew you had it in you :)

  140. Comment by gore — January 15, 2008 @ 10:16 am

  141. Doug Says:
    January 15th, 2008 at 10:21 am

    I noticed you didn't respond to my devastating critique of your previous post. If you don't know what you're talking about, it's better to shut up, to paraphrase a famous Austrian philosopher.
    Biology has become a very quantitative science as of lately. Gut-feeling arguments just don't cut it anymore.

    My apologies, for the most part I ignore what you say now. There are more able, interesting critics to read and listen to.
    But where is that devastating critique?

  142. Comment by Doug — January 15, 2008 @ 10:21 am

  143. Raevmo Says:
    January 15th, 2008 at 10:38 am

    Doug:

    My apologies, for the most part I ignore what you say now. There are more able, interesting critics to read and listen to.
    But where is that devastating critique?

    And I apologize to you, for being rude. My utterly and completely devastating critique concerned your oxymoronic postulation of deleterious mutations without phenotypic effects.

  144. Comment by Raevmo — January 15, 2008 @ 10:38 am

  145. Doug Says:
    January 15th, 2008 at 12:21 pm

    Contrary to your approach I'm interested in actually learning something. If there is something that shows that my earlier contention is indeed incorrect, great! I'll read it, consider it, and possibly adopt it.
    But where is the critique?

    Is it this?

    This doesn't make sense. A mutation is deleterious by definition if it induces a phenotype of lower fitness. Hence a mutation without a phenotypic effect cannot be deleterious.

    Natural selection can only act upon fitness, but how high is the heritability of 'fitness traits'?

    So, 'fitness traits' should be under strong directional selection, right? And therefore should display lower levels of genetic variation, right?
    Therefore 'fitness traits' should have high heritability, right?

    A mutation is deleterious by definition if it induces a phenotype of lower fitness.

    Nearly-neutral mutations can occur and not have an immediate effect at the level of the phenotype. Can those mutations accrue and eventually have a negative impact at the phenotypic level? Certainly, that's my point. Natural selection can't work at the level of the individual nucleotide, only at the level of the whole organism. Some mutations that occur will not have an immediate effect at the level of the organism, so they can't be directly selected again - allowing them to be passed into the next generation.
    Reproductive success isn't not an indicator of true-absolute value of genetic fitness, it's only relative to other organisms competing to reproduce. Would you say that this is a reflection of the integrity of the organisms genome? Isn't it quite possible that over numerous generations, as the mutations are accruing, that class of organisms could be headed towards extinction?

  146. Comment by Doug — January 15, 2008 @ 12:21 pm

  147. Raevmo Says:
    January 15th, 2008 at 1:40 pm

    Doug:

    Contrary to your approach I'm interested in actually learning something.

    You need to learn better mind-reading skills, as you incorrectly conclude that I'm not interested in learning something. I am and I do.

    Is it this?

    That's it. If you disagree I'd like to hear your definition of deleterious.

    So, 'fitness traits' should be under strong directional selection, right? And therefore should display lower levels of genetic variation, right?
    Therefore 'fitness traits' should have high heritability, right?

    Heritability (in the narrow sense) is additive genetic variance divided by phenotypic variance (h^2=VA/VP). If selection depletes additive genetic variation in fitness, the result will therefore be lower heritability, not higher. Indeed, fitness-related traits usually have lower heritabilities than, say, morphological traits. Nevertheless, considerable natural variation in fitness persists, for numerous possible reasons such as fluctuating selection pressures, sexually antagonistic selection, etc.

    Nearly-neutral mutations can occur and not have an immediate effect at the level of the phenotype.

    I'm not sure what you mean by "immediate effect", but nearly-neutral is not neutral, hence there must a (small) phenotypic effect.

    Natural selection can't work at the level of the individual nucleotide, only at the level of the whole organism.

    It can work at multiple levels, including below the individual level. There are genes (segregation distorters) that can cause the demise of sperm that do not carry them, thereby becoming over-represented among sperm.

    Some mutations that occur will not have an immediate effect at the level of the organism, so they can't be directly selected again - allowing them to be passed into the next generation.

    Agreed, that's possible. Like when you X-ray your balls a little too long.

    Reproductive success isn't not an indicator of true-absolute value of genetic fitness, it's only relative to other organisms competing to reproduce. Would you say that this is a reflection of the integrity of the organisms genome?

    I'm not sure what you mean by "integrity of the organisms genome".

    Isn't it quite possible that over numerous generations, as the mutations are accruing, that class of organisms could be headed towards extinction?

    Perhaps, yes. Some conservationists are worried this might happen to small populations ("genetic erosion").
    And indeed, it is probably more likely to happen in the absence of error repair. But the point is that error repair has not been shown to be a necessary condition for life. Early, relatively simple life with small genomes might have flourished without. Error repair could have evolved later.

  148. Comment by Raevmo — January 15, 2008 @ 1:40 pm

  149. Doug Says:
    January 15th, 2008 at 2:15 pm

    See, now there's a thoughtful and considerate post…. left out all insults, good job!

    I'm going to read it over more thoroughly and get back to you.
    PEACE

  150. Comment by Doug — January 15, 2008 @ 2:15 pm

  151. Bradford Says:
    January 15th, 2008 at 5:17 pm

    Raevmo:

    I don't know how Alberts et al. arrive at these numbers (my girlfriend stole my Alberts so I can't check), but let's suppose they are correct. Then by extending the argument even further, a mutation frequency hundredfold higher would limit an organism to about 600 essential genes. Since DNA error repair removes 99% of replication errors, an organism without error repair could have at most 600 genes. The smallest known genome of extant organisms is smaller than that. Hence, life can be sustained without error correction. QED.

    As I've been saying the claims and counter claims are testable. It should be noted though that a genome with 600 genes is a very small one and would be devoid of redundancy and a degree of robustness that would be found in larger genomes.

  152. Comment by Bradford — January 15, 2008 @ 5:17 pm

  153. Raevmo Says:
    January 15th, 2008 at 5:46 pm

    Bradford:

    As I've been saying the claims and counter claims are testable. It should be noted though that a genome with 600 genes is a very small one and would be devoid of redundancy and a degree of robustness that would be found in larger genomes.

    Fair enough. As long as we can agree that error repair is not necessarily a prerequisite for life.

  154. Comment by Raevmo — January 15, 2008 @ 5:46 pm

  155. valerie Says:
    January 15th, 2008 at 6:07 pm

    Bradford wrote:

    As I've been saying the claims and counter claims are testable.

    No, you've been saying that error correction is essential in principle for life, and that any genome will degrade without it.

    Why is it so difficult to admit that you were wrong?

  156. Comment by valerie — January 15, 2008 @ 6:07 pm

  157. Doug Says:
    January 15th, 2008 at 6:22 pm

    Valerie,

    Are you claiming that a genome will not degrade if there is no error correction machinery in place?

    Why is it so difficult to admit that you were wrong?

    Why do you phrase it like this? You assume that he is definitely wrong, he knows it, and the only thing in his way is his inability to admit it.
    It just seems like an odd way to discuss these things - but it also seems typical of how you handle yourself here.

  158. Comment by Doug — January 15, 2008 @ 6:22 pm

  159. Raevmo Says:
    January 15th, 2008 at 6:43 pm

    Doug:

    Are you claiming that a genome will not degrade if there is no error correction machinery in place?

    That is possible. A genome will degrade only if mutations are added to the population at a higher rate than they are removed. Error correction is one way to remove mutations, selection is another. Without error correction, if the mutation rate is small enough, there will be no meltdown, because selection removes enough mutations. It's as simple as that.

  160. Comment by Raevmo — January 15, 2008 @ 6:43 pm

  161. Doug Says:
    January 15th, 2008 at 6:45 pm

    Without error correction, if the mutation rate is small enough, there will be no meltdown, because selection removes enough mutations. It's as simple as that.

    I understand the point you're making. But that's not what I directed at Valerie, I simply asked if the genome would not degrade.

  162. Comment by Doug — January 15, 2008 @ 6:45 pm

  163. Raevmo Says:
    January 15th, 2008 at 6:52 pm

    Doug:

    I understand the point you're making. But that's not what I directed at Valerie, I simply asked if the genome would not degrade.

    It will not under the right circumstances. Smaller genome and smaller mutation rate making those circumstances more likely.

  164. Comment by Raevmo — January 15, 2008 @ 6:52 pm

  165. Doug Says:
    January 15th, 2008 at 6:55 pm

    Without error correction, if the mutation rate is small enough, there will be no meltdown, because selection removes enough mutations. It's as simple as that.

    Selection doesn't work at the level of individual nucleotide mutation, only at the level of the whole organism. So every mutation that occurs will not be removed by selection, allowing them to accrue.

  166. Comment by Doug — January 15, 2008 @ 6:55 pm

  167. Raevmo Says:
    January 15th, 2008 at 7:10 pm

    Doug:

    Selection doesn't work at the level of individual nucleotide mutation, only at the level of the whole organism. So every mutation that occurs will not be removed by selection, allowing them to accrue.

    OK, I should have said non-neutral mutations. Neutral mutations are irrelevant for the argument anyway. Do you get it now?

  168. Comment by Raevmo — January 15, 2008 @ 7:10 pm

  169. Bradford Says:
    January 15th, 2008 at 7:14 pm

    Valerie:

    No, you've been saying that error correction is essential in principle for life, and that any genome will degrade without it.

    I said error correction is essential. Not in principle. But because that is my view based on the data I'm familiar with. My view is subject to testing. I could be wrong but could be right as well.

    Why is it so difficult to admit that you were wrong?

    You have no empirical evidence showing that I'm wrong. Why is it so difficult for you to maintain an open mind?

  170. Comment by Bradford — January 15, 2008 @ 7:14 pm

  171. Bradford Says:
    January 15th, 2008 at 7:23 pm

    Raevmo:

    It will not under the right circumstances. Smaller genome and smaller mutation rate making those circumstances more likely.

    Disagree. Minimal function requires a certain size level in my view. Organisms with extremely small genomes tend to be obligate parasites being dependent on other organisms for needs their own genomes are unable to meet. There is scant evidence that cellular life would be sustainable when the gene count falls to a couple hundred genes or so.

  172. Comment by Bradford — January 15, 2008 @ 7:23 pm

  173. hrun Says:
    January 15th, 2008 at 8:28 pm

    You have no empirical evidence showing that I'm wrong. Why is it so difficult for you to maintain an open mind?

    The point is that you make the argument that DNA repair/error correction is a prerequisite. You are being challenged because you do not have sufficient data to support your position. Thus, you are simply making an assertion without evidence.

    Our minds were quite open: You made an assertion. We show that neither logically nor biologically your assertion is supported. Thus, we reject it.

    I said error correction is essential. Not in principle. But because that is my view based on the data I'm familiar with. My view is subject to testing. I could be wrong but could be right as well.

    So error correction is essential– but it is not essential in principle? Then what was your so called 'argument' that 'Extinction is the logical prediction.'? That sounds like you are making an argument in principle and not based on data.

  174. Comment by hrun — January 15, 2008 @ 8:28 pm

  175. hrun Says:
    January 15th, 2008 at 8:36 pm

    Raevmo:

    It will not under the right circumstances. Smaller genome and smaller mutation rate making those circumstances more likely.

    Bradford:

    Disagree.

    And immediately following, Bradford:

    Minimal function requires a certain size level in my view. Organisms with extremely small genomes tend to be obligate parasites being dependent on other organisms for needs their own genomes are unable to meet. There is scant evidence that cellular life would be sustainable when the gene count falls to a couple hundred genes or so.

    Your paragraph following the 'Disagree.' is a complete non-sequitur. Nothing in that paragraph actually runs counter to what Raevmo said.

  176. Comment by hrun — January 15, 2008 @ 8:36 pm

  177. Bradford Says:
    January 15th, 2008 at 8:57 pm

    You have no empirical evidence showing that I'm wrong. Why is it so difficult for you to maintain an open mind?

    hrun: The point is that you make the argument that DNA repair/error correction is a prerequisite. You are being challenged because you do not have sufficient data to support your position. Thus, you are simply making an assertion without evidence.

    and then there is this gem:

    Me: Minimal function requires a certain size level in my view. Organisms with extremely small genomes tend to be obligate parasites being dependent on other organisms for needs their own genomes are unable to meet. There is scant evidence that cellular life would be sustainable when the gene count falls to a couple hundred genes or so.

    Your paragraph following the 'Disagree.' is a complete non-sequitur. Nothing in that paragraph actually runs counter to what Raevmo said.

    Sure it does hrun. You see for all your bluster about evidence neither you or anyone else has answered my repeated requests to have a coherent model produced explaining how a putative self-replicator replicates its way to a cell. That is your small genome you don't want to discuss because the evidence for this pathway is nil. You can't even produce empirical data documenting small genomes yet you wish to contend that such imaginary entities withstand error correction. Document the genome before you strut about what it is able to do.

  178. Comment by Bradford — January 15, 2008 @ 8:57 pm

  179. hrun Says:
    January 16th, 2008 at 2:38 am

    Having a solar system with exactly nine planets is a prerequisite for life.

    You think my assertion is wrong? You think it is not supported by evidence?

    and then there is this gem:

    Bradford, even if no living organism was possible with 600 genes (which, by the way, is clearly disproven by Mycoplasma genitalium as it has 580,073 base pairs of DNA encoding 517 genes), that would still not invalidate the point that still does not invalidate the point that Raevmo made (Smaller genome and smaller mutation rate making those circumstances more likely.)

    You see for all your bluster about evidence neither you or anyone else has answered my repeated requests to have a coherent model produced explaining how a putative self-replicator replicates its way to a cell.

    What does that have to do with error correction being a prerequisite for life? Why don't you demand that I explain the properties of dark matter while you are at it?

    I said that you don't have evidence to support your assertion that error correction is a prerequisite for life. Simple as that.

  180. Comment by hrun — January 16, 2008 @ 2:38 am

  181. valerie Says:
    January 16th, 2008 at 4:15 am

    hrun,

    Reading over the thread again, it's clear that it simply did not occur to Bradford (until it was pointed out to him) that selection, as well as error correction, could cleanse deleterious mutations from a population.

    It explains many of his mistakes, including this statement:

    Loss of total error correction capacity would result in a steady degeneration of a genome would you agree?

    Given that he thought that error correction was the only means through which harmful mutations could be jettisoned, you can see why he thought it was essential.

    Of course he is now too embarrassed to admit his error, and so he is trying to change the subject.

  182. Comment by valerie — January 16, 2008 @ 4:15 am

  183. Bradford Says:
    January 16th, 2008 at 6:20 am

    hrun: Bradford, even if no living organism was possible with 600 genes (which, by the way, is clearly disproven by Mycoplasma genitalium as it has 580,073 base pairs of DNA encoding 517 genes), that would still not invalidate the point that still does not invalidate the point that Raevmo made (Smaller genome and smaller mutation rate making those circumstances more likely.)

    Sure. If we trace history back far enough we come upon a world filled with organisms like Mycoplasma genitalium don't we? Those smaller genomes are ideal if such an organism has a primate respiratory tract nearby. See how one-dimensional your analysis is hrun. These super-mini genomes don't come equipped with modern amenities. But that is not a problem for a parasite able to leach off the sustenance made possible by its larger genome host. The only problem is you won't have a handy primate or other suitable host in this putative primordial world. Starvation would get them while genomic degradation is getting untracked. Then again perhaps Mycoplasma genitalium devolved through a process of gene loss.

    You see for all your bluster about evidence neither you or anyone else has answered my repeated requests to have a coherent model produced explaining how a putative self-replicator replicates its way to a cell.

    hrun: What does that have to do with error correction being a prerequisite for life?

    Lack of evidence for precellular genomes makes arguments about their capacities pointless does it not?

    Why don't you demand that I explain the properties of dark matter while you are at it?

    Well why not entertain us with some good stories. But stick with biology and tell us how those self-replicating molecules in an ancient prebiotic soup managed to find their way to a cell. Tell us how natural selection sifted only those molecules suitable to form a replicating cell and placed the information needed to encode them into nucleic acids. Describe the wonders of scientific evidence showing the assembly of needed codon sequences as well as the multiple enzymes needed for their transcription and translation. If you can do a song and dance while telling the story all the better. BTW, we know you believe this story even if you don't like telling it. Should we call it an assertion or are you going to use weasal words to depict your heartfelt beliefs?

    I said that you don't have evidence to support your assertion that error correction is a prerequisite for life. Simple as that.

    You don't have the evidence to support this counter assertion of yours. You would have us ignore the universality of the DNA repair function and pretend it is superfluous to some life forms even though all life forms have it. Of course imaginary life forms might get along without it but we'll never know will we?

  184. Comment by Bradford — January 16, 2008 @ 6:20 am

  185. Raevmo Says:
    January 16th, 2008 at 6:21 am

    Valerie:

    Of course he is now too embarrassed to admit his error, and so he is trying to change the subject.

    Ironic, isn't it? Bradford never allows his errors to be corrected. His ideas are therefore doomed to go extinct.

  186. Comment by Raevmo — January 16, 2008 @ 6:21 am

  187. Bradford Says:
    January 16th, 2008 at 6:24 am

    Valerie: Reading over the thread again, it's clear that it simply did not occur to Bradford (until it was pointed out to him) that selection, as well as error correction, could cleanse deleterious mutations from a population.

    It explains many of his mistakes, including this statement:

    Loss of total error correction capacity would result in a steady degeneration of a genome would you agree?

    Given that he thought that error correction was the only means through which harmful mutations could be jettisoned, you can see why he thought it was essential.

    It is equally clear that your thought processes are very shallow. Of course selection would remove fatal genetic changes. But selection is not a magic bullet when the mortality rate exceeds reproductive replacements. A continuous, unchecked decline in the reproductive fitness of an entire species would arrive at that point. The unsupported assertion is a contention that the reproductive rate is compensatory.

  188. Comment by Bradford — January 16, 2008 @ 6:24 am

  189. Bradford Says:
    January 16th, 2008 at 6:26 am

    Raevmo: Ironic, isn't it? Bradford never allows his errors to be corrected. His ideas are therefore doomed to go extinct.

    C'mon Raevmo. Get busy and supply us with evidence for those putative prebiotic pathways to life you've been claiming. If this is about evidence where is yours?

  190. Comment by Bradford — January 16, 2008 @ 6:26 am

  191. Zachriel Says:
    January 16th, 2008 at 7:13 am

    Bradford: But that is not a problem for a parasite able to leach off the sustenance made possible by its larger genome host. The only problem is you won't have a handy primate or other suitable host in this putative primordial world.

    Those silly parasitic primates. Like all metazoans, living off the hard work of other organisms. Maybe if they had a real genome …

    In any case, the question wasn't the origin of genomes, but your statement that "The error correction function is essential." I see you started a new thread, DNA Repair- A Vital Function.

  192. Comment by Zachriel — January 16, 2008 @ 7:13 am

  193. Bradford Says:
    January 16th, 2008 at 7:42 am

    Zachriel:

    Those silly parasitic primates. Like all metazoans, living off the hard work of other organisms. Maybe if they had a real genome "¦

    In any case, the question wasn't the origin of genomes, but your statement that "The error correction function is essential." I see you started a new thread, DNA Repair- A Vital Function.

    Yes, those parasitic organisms with those tiny genomes. Small genomes come with trade-offs. Those ancient tiny genomes would have had to sacrifice some self-sufficiency for size and without those easy eukaryotic organisms to prey on. But I'm sure your side can imagine some suitable tiny genomed organism to prey on. Imagination is the refuge of Darwinists when evidence fails.

  194. Comment by Bradford — January 16, 2008 @ 7:42 am

  195. hrun Says:
    January 16th, 2008 at 8:45 am

    Sure. If we trace history back far enough we come upon a world filled with organisms like Mycoplasma genitalium don't we? [...]

    You just don't get it, do you? You said organisms with under 600 genes are simply not possible. I proved you wrong. DONE. I did not argue that Mycoplasma genitalium was one of the earliest organisms. That would just be plain stupid.

    A continuous, unchecked decline in the reproductive fitness of an entire species would arrive at that point.

    THere you go again with your false 'logical' argument.

  196. Comment by hrun — January 16, 2008 @ 8:45 am

  197. JOHN_A_DESIGNER Says:
    January 16th, 2008 at 2:04 pm

    Bradford it appears has got himself into another heated debate. However, I think he has raised a number of interesting points.

    *To Zachriel: Yes, those parasitic organisms with those tiny genomes. Small genomes come with trade-offs. Those ancient tiny genomes would have had to sacrifice some self-sufficiency for size and without those easy eukaryotic organisms to prey on. But I'm sure your side can imagine some suitable tiny genomed organism to prey on. Imagination is the refuge of Darwinists when evidence fails.

    *To Valerie: It is equally clear that your thought processes are very shallow. Of course selection would remove fatal genetic changes. But selection is not a magic bullet when the mortality rate exceeds reproductive replacements. A continuous, unchecked decline in the reproductive fitness of an entire species would arrive at that point. The unsupported assertion is a contention that the reproductive rate is compensatory.

    *To Hrun: Sure it does hrun. You see for all your bluster about evidence neither you or anyone else has answered my repeated requests to have a coherent model produced explaining how a putative self-replicator replicates its way to a cell. That is your small genome you don't want to discuss because the evidence for this pathway is nil. You can't even produce empirical data documenting small genomes yet you wish to contend that such imaginary entities withstand error correction. Document the genome before you strut about what it is able to do.

    .*To Hrun: You just don't get it, do you? You said organisms with under 600 genes are simply not possible. I proved you wrong. DONE. I did not argue that Mycoplasma genitalium was one of the earliest organisms. That would just be plain stupid.

    This discussion (if you call trading insults a discussion) provoked a number of questions in my own mind. Here is just a short list:

    What is the smallest possible genome? Isn't that relevant to questions about OOL? Does Hrun know. Does anyone know? Was there an earliest cell, proto-cell, or replicater? If so what was it like? Does natural selection explain everything? Was natural selection operating pre-biotically? What evidence is there for that? Can simple hypothetical replicaters evolve up to protozoa"¦metazoa"¦ up to plant, animals and man, by a process that is completely and totally unintelligent and undirected. Has anyone written a book explaining and describing step by step how that happens? Can you give me the author and title? ("¦and the price?):smile: Does anyone know? Do any of you know of anyone who knows?

    *C'mon Raevmo. Get busy and supply us with evidence for those putative prebiotic pathways to life you've been claiming. If this is about evidence where is yours?

    I agree. If Raevmo (or Hrun, Zachriel or Valerie) were able to provide convincing and compelling evidence that life emerged from non-life by a mindless natural process, they would win. So, where is it? Is your claim about evidence real or is it just hubris?

  198. Comment by JOHN_A_DESIGNER — January 16, 2008 @ 2:04 pm

  199. Zachriel Says:
    January 16th, 2008 at 2:23 pm

    JOHN_A_DESIGNER: Isn't that relevant to questions about OOL?

    There is no complete theory of abiogenesis. The first life form on Earth may have been a lucky accident, a natural property of carbon and liquid water, a unique circumstance, seeded by comets, or even a Divine Miracle. But let's start from what we do know.

    * We know that life did not always exist on Earth.
    * We know that life is essentially a chemical process.
    * We know that complex compounds can spontaneously assemble under a variety of conditions.
    * We know the first life appears in a primordial world.
    * We know the first life appears shortly after liquid water forms.
    * We know that life evolved and diversified from those primitive forebearers.
    * We have some molecular evidence of how fundamental mechanisms may have arisen, including the genetic code.
    * Much of the earliest history of life is shrouded by the intervening eons and left few physical clues other than extant life itself.

    JOHN_A_DESIGNER: Does natural selection explain everything?

    No.

    JOHN_A_DESIGNER: Was natural selection operating pre-biotically?

    Probably.

    JOHN_A_DESIGNER: Can simple hypothetical replicaters evolve up to protozoa"¦metazoa"¦ up to plant, animals and man, by a process that is completely and totally unintelligent and undirected?

    * We know that life evolved and diversified from primitive forebearers.

    As most of the evidence for the origin of life is found in extant organisms, you really need to understand the evidence supporting the Theory of Evolution, including Common Descent.

  200. Comment by Zachriel — January 16, 2008 @ 2:23 pm

  201. JOHN_A_DESIGNER Says:
    January 17th, 2008 at 7:50 am

    Zachriel wrote:

    There is no complete theory of abiogenesis. The first life form on Earth may have been a lucky accident, a natural property of carbon and liquid water, a unique circumstance, seeded by comets, or even a Divine Miracle. But let's start from what we do know.

    I would argue that we can and should eliminate the idea life on earth is the result of some kind of lucky accident. Just as it's impossible for a universe full of monkeys to type a Shakespeare sonnet by chance it's impossible for life to be just a lucky accident. Of course, you're free to believe that chance can do anything if you wish. I don't have enough faith for such a belief.

    For the following points I have made comments in parenthesis.

    * We know that life did not always exist on Earth. (I agree.)
    * We know that life is essentially a chemical process. (Life is an information processing phenomena. Chemistry alone does not explain self-replicating life. You have to explain where the information came from.)
    * We know that complex compounds can spontaneously assemble under a variety of conditions. (What develops by means of known chemical process lacks specificity + the multifunctional complexity that characterizes all living things.)
    * We know the first life appears in a primordial world. (I agree.)
    * We know the first life appears shortly after liquid water forms. (I agree.)
    * We know that life evolved and diversified from those primitive forebearers. (But we don't know how. The evidence at present is purely circumstantial. I think it is more accurate to describe that as a belief rather than knowledge. Science is figuring out how something happens.)
    * We have some molecular evidence of how fundamental mechanisms may have arisen, including the genetic code. (But, this is still a very, very speculative area.)
    * Much of the earliest history of life is shrouded by the intervening eons and left few physical clues other than extant life itself. (Agreed)

    I then asked:

    JOHN_A_DESIGNER: Can simple hypothetical replicaters evolve up to protozoa"¦metazoa"¦ up to plant, animals and man, by a process that is completely and totally unintelligent and undirected?

    And you replied:

    We know that life evolved and diversified from primitive forbearers.

    But once again you give no explanation as to how. That is a statement of belief not knowledge.

    As most of the evidence for the origin of life is found in extant organisms, you really need to understand the evidence supporting the Theory of Evolution, including Common Descent.

    Again, explain to me how complexity emerges from simplicity by unintelligent and blind natural processes alone.

  202. Comment by JOHN_A_DESIGNER — January 17, 2008 @ 7:50 am

  203. Zachriel Says:
    January 17th, 2008 at 8:51 am

    JOHN_A_DESIGNER: I would argue that we can and should eliminate the idea life on earth is the result of some kind of lucky accident. Just as it's impossible for a universe full of monkeys to type a Shakespeare sonnet by chance it's impossible for life to be just a lucky accident.

    You don't know that. Unlike the Shakespearean Sonnet, you have no way to calculate the odds.

    JOHN_A_DESIGNER: Of course, you're free to believe that chance can do anything if you wish. I don't have enough faith for such a belief.

    You are misrepresenting what "chance" means in science. It is possible that under perfect conditions life may only arise only once per million planets. This is not only possible, but a claim that could {conceivably} be investigated. A claim that some cosmic improbability occurred, which is certainly possible, would {presumably} not yield to scientific investigation. But again, most scientists in the field believe that life's origin is due to natural processes.

    JOHN_A_DESIGNER: We know that life is essentially a chemical process. (Life is an information processing phenomena. Chemistry alone does not explain self-replicating life. You have to explain where the information came from.)

    You'd best provide a valid scientific definition of information. Nevertheless, you didn't actually disagree.

    JOHN_A_DESIGNER: * We know that complex compounds can spontaneously assemble under a variety of conditions. (What develops by means of known chemical process lacks specificity + the multifunctional complexity that characterizes all living things.)

    Again, you didn't actually disagree.

    JOHN_A_DESIGNER: * We know that life evolved and diversified from those primitive forebearers. (But we don't know how.

    Again, you didn't actually disagree. And we do have substantial evidence of how.

    JOHN_A_DESIGNER: But once again you give no explanation as to how. That is a statement of belief not knowledge.

    That vast majority of biologists would strongly disagree. The Theory of Evolution leads to a wide variety of specific and distinguishing empirical predictions, including concerning the mechanisms of biological divergence over evolutionary time. For instance, the observed rates of evolutionary change must be at least as great as the fastest rate of evolutionary change determined from the historical record. Indeed, the observed rates of evolutionary change are much, much faster than required to explain the historical record.

    JOHN_A_DESIGNER: Again, explain to me how complexity emerges from simplicity by unintelligent and blind natural processes alone.

    Evolutionary processes are more than capable of generating complexity.

  204. Comment by Zachriel — January 17, 2008 @ 8:51 am

  205. JOHN_A_DESIGNER Says:
    January 17th, 2008 at 4:14 pm

    Zachriel I don't have time for a point by point response but this should keep you busy for a while.
    I wrote:

    JOHN_A_DESIGNER: I would argue that we can and should eliminate the idea life on earth is the result of some kind of lucky accident. Just as it's impossible for a universe full of monkeys to type a Shakespeare sonnet by chance it's impossible for life to be just a lucky accident.

    Zachriel responded:

    You don't know that. Unlike the Shakespearean Sonnet, you have no way to calculate the odds.

    Sure I do. Here is something I wrote last summer on a thread started by Albert De Roos.

    I am sure you already know that both in DNA and RNA the nucleotides (A,T,C,G in DNA or A,U,C,G in RNA) bond in a specific predetermined way. For example, with RNA, (In keeping with the fashionable "RNA first" scenario) A always bonds with U, and C always bonds with G as is illustrated by the following:

    C-G
    A-U
    A-U
    G-C
    U-A
    A-U
    G-C
    G-C
    G-C

    However, this law only applies along the "rungs"(horizontally in the example above) of the RNA molecule. If we look vertically along the sides we find that the chemical bonding is completely different. For example, consider the following strand of RNA:

    CAAGUAGGGAGUUGAUAAGGGAUAUAAUCACAAGUAGUACA >(continues)>

    AGU AUCAGGGUCUAAAACUGGGAGUUGAUAAGGGUCUGCAAUUAGA
    (note: for the sake of space I've turned vertical strand horizontal)

    Now, what affinity do any of the chemicals have with each other, in the vertical? According Michael Polanyi and others, the bonds along the side between C,G,A,U do not have any deterministic affinity. One can arrange them any way one wishes, randomly or purposely with some kind of code. For example, in the above strand I've encoded a brief message in English.

    Now there are only few ways IMO that we can logically explain how the original code got into the first RNA molecules: (1)chance (2) intelligence (3)some unknown natural law or (4)the genetic code is somehow eternal.

    Personally I believe that we can quickly eliminate #1 and #4. All basic calculations show that trying to assemble even a simple hypothetical "replicater" one quickly uses up all the time and chance that is available in the universe. As for #4, how can you have something eternal in a non-eternal universe?

    But if we consider #3 wouldn't those new laws act something like intelligence?

    Without appealing to intelligence we can do nothing more than calculate the odds. Because there are 64 codons in RNA as well as DNA sequences. We can presently calculate the odds of being 1 in 64 for any single specified codon. Of course you have to have to multiply 1/64 for every codon you add to the strand. Even calculating the odds of of something simple like a 100 amino acid protein uses up most of the time and chance one has available in the known universe.

  206. Comment by JOHN_A_DESIGNER — January 17, 2008 @ 4:14 pm

  207. Raevmo Says:
    January 17th, 2008 at 5:04 pm

    JAD:

    Even calculating the odds of of something simple like a 100 amino acid protein uses up most of the time and chance one has available in the known universe.

    Can you explain why that is the correct way of calculating the odds? In order to calculate the odds you need a specific scenario for the evolution of proteins. What's your specific scenario?

  208. Comment by Raevmo — January 17, 2008 @ 5:04 pm

  209. Zachriel Says:
    January 17th, 2008 at 7:44 pm

    JOHN_A_DESIGNER: Now there are only few ways IMO that we can logically explain how the original code got into the first RNA molecules: (1)chance (2) intelligence (3)some unknown natural law or (4)the genetic code is somehow eternal.

    Just because you make a list doesn't make it exhaustive. All four options can be eliminated because we know of a process that can result in the ordering of long sequences. It's called evolution.

    Try a simple case. Imagine a soup of letters and words that randomly mutate and recombine. We might limit our population, selecting only the longest words in each generation, "”but if a mutant doesn't form a word, it's immediately eliminated from the population. According to your arithmetic, how many mutations would it take to evolve even a short word of, say, ten letters?

    There's ~10^14 possible ten-letter sequences and ~10^4 ten-letter words. Are you saying we would have to examine ~10^10 mutants on average to find one of these ten-letter words?

  210. Comment by Zachriel — January 17, 2008 @ 7:44 pm

  211. JOHN_A_DESIGNER Says:
    January 18th, 2008 at 1:08 pm

    Words and letters don't have intrinsic meaning. nitehgnibenigaswehtdowr doesn't have a clue how to arrange or rearrange it self into a meaningful sequence. You're trying to introduce a selection mechanism into the process. The mechanism, like a primitive computer, may itself be mindless but from where did it get its rules? So, you can claim that "˜evolution did it' but you haven't explained how evolution got that capacity in the first place. Where is the evidence the codons of RNA or DNA or amino acids starting alone in a primitive hostile environment have a capacity by themselves to create meaningful sequences that can evolve into anything?
    For example, Paul Davie summarizes the problem succinctly when he writes:

    "life is more than just complex chemical reactions. The cell is also an information storing, processing and replicating system. We need to explain the origin of this information, and the way in which this information processing machinery came to exist"¦The problem of how meaningful or semantic information can emerge spontaneously from a collection of mindless molecules subject to blind and purposeless forces presents a deep conceptual challenge."

  212. Comment by JOHN_A_DESIGNER — January 18, 2008 @ 1:08 pm

  213. Zachriel Says:
    January 18th, 2008 at 1:26 pm

    JOHN_A_DESIGNER: You're trying to introduce a selection mechanism into the process.

    The concept is that short sequences can evolve into longer sequences.

    JOHN_A_DESIGNER: Where is the evidence the codons of RNA or DNA or amino acids starting alone in a primitive hostile environment have a capacity by themselves to create meaningful sequences that can evolve into anything?

    There is no valid theory of abiogenesis, but your arithmetic presumes to know not only the type of molecule, but the length molecule required to make a primitive replicator. There is nothing known that indicates that short molecules (or small network of interacting molecules) could not act as primitive replicators. Your math presumes to prove something it doesn't do.

    JOHN_A_DESIGNER: Even calculating the odds of of something simple like a 100 amino acid protein uses up most of the time and chance one has available in the known universe.

    Iif all you are trying to prove is that complex proteins don't assemble in a single step from random nucleotides, then you are correct.

  214. Comment by Zachriel — January 18, 2008 @ 1:26 pm

  215. JOHN_A_DESIGNER Says:
    January 18th, 2008 at 5:03 pm

    The real experimental work done on these so called replicators is not very promising at the moment. Replictors need to do more than replicate they need to be able to evolve into functioning cellular life. Describe to me step-by-step how that happens. Just claiming that it could happen is not scientific evidence– it's wishful thinking. I think at present we're still at step one. Life still appears to me to be very improbable. Francis Crick once refered to it as "almost a miracle."

  216. Comment by JOHN_A_DESIGNER — January 18, 2008 @ 5:03 pm

  217. Zachriel Says:
    January 18th, 2008 at 6:18 pm

    JOHN_A_DESIGNER: Describe to me step-by-step how that happens.

    There is no complete theory of abiogenesis.

    JOHN_A_DESIGNER: Just claiming that it could happen is not scientific evidence"“ it's wishful thinking.

    The negation of your claim couldn't happen is could happen, not did happen.

    JOHN_A_DESIGNER: I would argue that we can and should eliminate the idea life on earth is the result of some kind of lucky accident…

    Zachriel: You don't know that. Unlike the Shakespearean Sonnet, you have no way to calculate the odds.

    JOHN_A_DESIGNER: Sure I do.

    Then you provided a calculation based upon some faulty strawman theory. No one knows what the simplest replicator might be. Nor how likely life is even given the appropriate conditions.

    Zachriel: We know that life evolved and diversified from primitive forbearers.

    JOHN_A_DESIGNER: But once again you give no explanation as to how. That is a statement of belief not knowledge.

    Zachriel: As most of the evidence for the origin of life is found in extant organisms, you really need to understand the evidence supporting the Theory of Evolution, including Common Descent.

    JOHN_A_DESIGNER: Again, explain to me how complexity emerges from simplicity by unintelligent and blind natural processes alone.

    Which I provided to you above. Evolutionary processes.

    JOHN_A_DESIGNER: The real experimental work done on these so called replicators is not very promising at the moment.

    As you wave away the strong scientific support for the Theory of Evolution, I doubt that you would be able to properly judge the more speculative area of abiogenesis. By analogy, if someone continues to insist the Earth is fixed, a discussion of black holes would probably not be fruitful.

  218. Comment by Zachriel — January 18, 2008 @ 6:18 pm

  219. JOHN_A_DESIGNER Says:
    January 18th, 2008 at 11:08 pm

    Your right. I don't accept any theory on blindn faith. Any scientific theory should be open to scepticism and criticism. That' my view.
    I found this quote from Paul Davies. It sounds like he supports my analysis of the work done on replicators:

    In recent years, attempts have been made to build small and simple replicator molecules in the lab, and to subject them to environmental stresses to see if they evolve into better replicators. Modest success has been claimed. However, these experiments do not demonstrate molecular evolution in nature. They have yet to show that that the sort of small replicators that have been been painstakingly designed and fabricated in the laboratory will form spontaneously under plausible prebiotic conditions, and if they do, whether they will replicate well enough to evade error catastrophe. In short, nobody has a clue whether naturally occurring mini-replicators are even possible, let alone whether they got what it takes to evolve successfully. (Paul Davies, The Fifth Miracle, p133)

    It's nice to have an expert in my corner.

  220. Comment by JOHN_A_DESIGNER — January 18, 2008 @ 11:08 pm

  221. Zachriel Says:
    January 19th, 2008 at 12:46 am

    JOHN_A_DESIGNER (quoting): They have yet to show that that the sort of small replicators that have been been painstakingly designed and fabricated in the laboratory will form spontaneously under plausible prebiotic conditions, and if they do, whether they will replicate well enough to evade error catastrophe.

    A typical methodology for creating autocatalyzing molecules is to randomly create a few quandrillion random sequences, select those with the most catalytic activity, replicate them along with the occasional mutation, then repeatedly cycle this Darwinian process.

    JOHN_A_DESIGNER (quoting): In short, nobody has a clue whether naturally occurring mini-replicators are even possible, let alone whether they got what it takes to evolve successfully.

    Random polymers can evolve autocatalytic activity. When studying the problem, we continue to find evidence supporting the general hypothesis of a spontaneous origin of life.

    JOHN_A_DESIGNER: It's nice to have an expert in my corner.

    Paul Davies: I am a fierce opponent of so-called "Intelligent Design"

  222. Comment by Zachriel — January 19, 2008 @ 12:46 am

  223. JOHN_A_DESIGNER Says:
    January 21st, 2008 at 12:57 pm

    I did not claim that Paul Davies was a supporter of ID. I am well aware of that. I quoted him because he agrees that there are serious problems that need to be overcome before science can even hope to begin to explain the origin of life. What I admire in Davies is that he is able to set aside his personal beliefs and honestly and objectively to evaluate the evidence. IOW he personally believes, like you, that someday science will be able to explain the origin of life, but presently we don't have a clue what happened "in the beginning."

    All the experiments, at least that I am aware of, that have been done in creating autocatalyzing molecules have been done under intelligently conceived, intelligently controlled and guided laboratory conditions. That argues for intelligent design (because obviously it involves intelligent control and guidance) not the natural chemical origin and evolution of life. You have to do better than that to convince the skeptics, which includes not only creationists and IDist's, but non IDist's like Paul Davies, HubertYockey & Robert Shapiro (and others), that we have any idea how life began au natural.

    I have not found much substance in any of your responses. You don't reference any authorities (books, papers or articles) Instead you give me your beliefs and opinions and a lot of spin. Do you believe that your opinion alone is enough to convince the skeptics? Like me, I think they are looking for some hard scientific evidence, not simply belief and opinion etc.. If you have such evidence where is it?

  224. Comment by JOHN_A_DESIGNER — January 21, 2008 @ 12:57 pm

  225. Zachriel Says:
    January 21st, 2008 at 8:43 pm

    JOHN_A_DESIGNER: I did not claim that Paul Davies was a supporter of ID.

    No, but you did claim he was in your corner. In fact, Davies is a fierce opponent of Intelligent Design and believes that abiogenesis occurred through some natural processes, albeit little understood. As you respect his scientific skepticsm, how do you think he could reach this tentative conclusion based on what seems at first blush to be such tenuous evidence?

    JOHN_A_DESIGNER: I quoted him because he agrees that there are serious problems that need to be overcome before science can even hope to begin to explain the origin of life.

    Of course.

    JOHN_A_DESIGNER: All the experiments, at least that I am aware of, that have been done in creating autocatalyzing molecules have been done under intelligently conceived, intelligently controlled and guided laboratory conditions.

    But that does not preclude useful science being done. In any case, a common method of making autocatalyzing molecules is to create a few quadrillion randomly, then cycling through bouts of selection and replication. Via this darwinian process, enzymes have been able to copy templates with up to 95% fidelity. Of course, the environments are highly contrived.

    JOHN_A_DESIGNER: That argues for intelligent design (because obviously it involves intelligent control and guidance) not the natural chemical origin and evolution of life.

    No more so than dissolving salt in a laboratory beaker argues for intelligent dissolving.

  226. Comment by Zachriel — January 21, 2008 @ 8:43 pm

Leave a Reply

You must be logged in to post a comment.

  • Featured Books


    The Design Matrix: A Consilience of Clues by Mike Gene
    Your Inner Fish: A Journey into the 3.5-Billion-Year History of the Human Body

    Catalyzing Inquiry at the Interface of Computing and Biology

    System Modeling in Cellular Biology: From Concepts to Nuts and Bolts

    The Plausibility of Life By Marc W. Kirschner and John C. Gerhart

    Agents Under Fire by Angus Menuge

    Life's Solution by Simon Conway Morris

    Information Theory, Evolution and the Origin of Life by Hubert P. Yockey

    The Fifth Miracle by Paul Davies

    Nature, Design, and Science by Del Ratzsch

    Origination of Organismal Form by Muller & Newman

    Biased Embryos and Evolution by Wallace Arthur

    Rare Earth by Peter Ward and Donald Brownlee

    The Privileged Planet by Guillermo Gonzalez and Jay Richards

    The Way of the Cell by Franklin Harold

    The Volitional Brain by Benjamin Libet

    Evolution in Four Dimensions by Eva Jablonka & Marion Lamb

    The Evolution-Creation Struggle by Michael Ruse




Telic Thoughts is proudly powered by WordPress
Hosting provided by College Crunch.

Entries (RSS) and Comments (RSS).