Surface Appearences
by BradfordTom Gilson has a blog entry titled Knowledge and Bias: A First Response to Tom Clark One striking aspect of the exchange between Tom Gilson and Tom Clark is its substantive dialog and the civil nature of it. My focus is a small part of it, specifically a portion of a comment made by Tom Clark. The first quoted comment segment:
That prediction doesn’t stem from a naturalistic bias, but from the nature of science and more generally the project of gaining intersubjective knowledge: understanding things and their connections tends to unify our view of the world, and the world that science reveals is what we ordinarily call nature. I also say that “Should something categorically immaterial someday play a role in scientific explanations, so be it, but for the time being there’s no indication that dualism will carry the day.”
The study of nature allows for the immaterial. Minds exist and the presumption that they are either physical or emergent properties of brains is, in many instances, superfluous to the analysis of cognitive and behavioral phenomenon. Of course studies can encompass brain cells and neural biochemistry but such studies are not essential to many scientific endeavors which have yielded useful data. To borrow a phrase, materialist presumptions are vacuous to such endeavors. More from Clark's comment:
Same goes for the supernatural. In my exchange with Goetz and Taliaferro I say: “The naturalist agrees that science can’t categorically exclude immaterial God, souls, free will and mental causes, that is, it can’t categorically rule out their existence, but disagrees that there are scientific, empirical, intersubjective grounds for reasonably believing that they exist.” So all I’m saying is that, *if* you stick with science and more broadly intersubjective empiricism as grounds for belief, the chances are you’ll end up with a picture of a unified reality, not one divided into two categorically different realms, natural vs. supernatural.
One of the difficulties with a natural/supernatural paradigm is an inability to clearly delineate boundary lines in advance of an assessment. For example, much of what we currently understand, based on the application of empirical approaches, would have seemed supernatural in an earlier era of history. Relativity and quantum theories render explanations which run counter to the "common sense" of the uninitiated. Bizarre cosmological structures like neutron stars and black holes would have seemed like fanciful concepts to earlier generations. It's not that they are fanciful, only that our consideration of what constitutes fanciful can be a construct of our current scientific understanding subject to revision by means of scientific breakthroughs. Wedding scientific knowledge to technology illustrates the point. 21st century technology, introduced into an ancient culture, could convey a supernatural impression. A false one. The boundary between natural and supernatural is not necessarily discernible.
January 25th, 2009 at 8:42 pm
Fanciful and supernatural are different categories. Quantum mechanics, relativity and black holes became mainstream only after sufficient empirical evidence for them had accumulated. Supernatural, by definition, cannot be tested empirically.
Comment by olegt — January 25, 2009 @ 8:42 pm
January 25th, 2009 at 8:48 pm
Olegt:
Yes and what can be tested is also a function of our technological capacities. Definitions reveal little but semantic utility.
Comment by Bradford — January 25, 2009 @ 8:48 pm
January 25th, 2009 at 9:18 pm
I guess your point is that Intelligent Design is one of those things which at first looks supernatural but will eventually be incorporated into science.
This is not saying much because it could apply to anything, such as Astrology. Any idea could become part of science, if someone formulates a testable entailed hypothesis and then independent scientists affirm it empirically.
However, I am unaware of any testable entailed hypotheses, either for Astrology or Intelligent Design. As such, I treat them with equal seriousness.
Comment by terrycvn — January 25, 2009 @ 9:18 pm
January 25th, 2009 at 9:31 pm
In their recent book, Naturalism, Stewart Goetz and Charles Taliaferro write: “if strict naturalism is true, then there is no ultimate and irreducible teleological explanation of any event, let alone our actions, in terms of purpose; there is no libertarian freedom of the will; there are no irreducible experiences of pleasure and pain; there is no enduring self or soul of any kind…”
What do I believe with the most conviction? (1) That I have free will, and that I am free moral agent who is responsible for his moral choices. (2)That my life has purpose and meaning and that this purpose and meaning transcends what I observe out there in nature.
How does strict naturalist explain my 2 convictions? Most of what I have read doesn’t try to explain them. Instead these are an example of the kind of things that the strict naturalist tries to explain away.
Comment by JOHN_A_DESIGNER — January 25, 2009 @ 9:31 pm
January 25th, 2009 at 10:45 pm
I've just come across your blog which I'm enjoying. I thought some of your readers might be interested in an interview I conducted with Steve Fuller last year, regarding his book, "Dissent Over Dissent". If so, here is the link:
http://whoeverfightsmonsters-nhuthnance.blogspot.com/2008/08/dissent-over-descent-steve-fuller.html
Comment by nhuthnance — January 25, 2009 @ 10:45 pm
January 25th, 2009 at 11:07 pm
"Supernatural, by definition, cannot be tested empirically."
Not sure about that, since supernatural hypotheses proffered by creationists and ID advocates are routinely subject to scientific evaluation, e.g., there's no credible scientific evidence that the earth is 5,000 years old. This is why creationism isn't taught in science class, except perhaps as an example of failed science. Studies of anonymous intercessory prayer have been conducted producing negative results, which helps disconfirm (or at least fails to confirm) the hypothesis that God is interceding. So it seems that supernatural phenomena, if they are sufficiently specified, are indeed empirically testable. There's a very good paper, Can science test supernatural worldviews?, that goes into the Bayesian details of why science is perfectly capable of evaluating supernatural hypotheses.
best,
Tom Clark
http://www.naturalism.org
Comment by Tom Clark — January 25, 2009 @ 11:07 pm
January 25th, 2009 at 11:35 pm
Bradford,
I'd go further – the distinction between the natural and supernatural is a complete mess and has been for a long time.
J_A_D gives a great example – 'strict naturalism' by the authors definition. But David Chalmers would reject the implicit materialism in that definition and argue that immaterial aspects of thought (possibly in multiple forms) would still be naturalistic explanations. Bostrom and others would argue that there could be a world beyond our universe, complete with an agent or agents who could instantiate miracles, etc – we could be in a simulated world. And he'd still call it all 'naturalistic'.
Calling something naturalistic or supernatural will, in my experience, tell you less about what's being talked about and more about the person you're talking with.
Comment by nullasalus — January 25, 2009 @ 11:35 pm
January 26th, 2009 at 12:52 pm
Well put. About the only meaningful distinction, IMO, that can be made between the relative terms "nature" and "super-nature", is that whatever they might otherwise be, there is an asymmetrical dependency.
Comment by kornbelt888 — January 26, 2009 @ 12:52 pm
January 26th, 2009 at 1:09 pm
Very good John. Why try to explain them away apart from the philosophical discomfort they cause some? Naturalists want to claim a special relationship between their views and the empirical studies we call science. They would thus be in a position to claim the cloak of objectivity in which they would wrap their points of view. They need to be stripped of that pretense. Lay those bare thoughts out to be seen for what they truly are.
Comment by Bradford — January 26, 2009 @ 1:09 pm
January 26th, 2009 at 1:23 pm
Tom Clark:
Hi Tom. I had to rescue your comment from the spam queue- the default site for first time commenters. Like Gilson I believe in a God whose capabilities exceed the limitations of natural laws. However the reason I argue that boundary lines between the natural and the supernatural are not clearly delineated has to do with a very basic feature of science itself- the ability to make accurate predictions. We can of course do that with respect to natural phenomenon under specifiable conditions. These are the types of predictions that end up in text books and are thought of as knowledge. One thing to note is that knowledge is linked to technology. As time goes on we discover new and sometimes counterintuitive ideas which were not testable in the past. Having said that I would agree that some claims are intrinsically supernatural. After all the claim that Christ rose from the dead must fall within that realm would you not agree?
Comment by Bradford — January 26, 2009 @ 1:23 pm
January 26th, 2009 at 1:36 pm
Speaking for myself I have long thought that genetics looks like the study of encoded messages which has an unmistakable telic property although not necessarily supernatural.
Comment by Bradford — January 26, 2009 @ 1:36 pm
January 26th, 2009 at 1:49 pm
Bradford:
Others have long thought that studying the entrails of freshly slaughtered animals looks like the study of encoded messages.
Comment by Raevmo — January 26, 2009 @ 1:49 pm
January 26th, 2009 at 1:58 pm
Raevmo:
Yeah, one can readily see the analogy between nitrogenous base polymers coding for amino acids and stomach guts.
Comment by Bradford — January 26, 2009 @ 1:58 pm
January 26th, 2009 at 2:08 pm
nullasalus:
I agree — to prevent confusion it's better to be specific about what causes what (e.g. who or what is the "designer") and to hell with ill-defined labels.
The dichotomy material vs immaterial suffers from the same shortcomings as natural vs supernatural. Let's just be specific.
Comment by Raevmo — January 26, 2009 @ 2:08 pm
January 26th, 2009 at 2:12 pm
Bradford:
I think it was Banach (of the Banach spaces) who said that good mathematicians see analogies between theorems and great mathematicians see analogies between analogies. Or something like that.
Comment by Raevmo — January 26, 2009 @ 2:12 pm
January 26th, 2009 at 4:09 pm
One can readily see the analogy between reading messages in nitrogenous base polymers and reading messages in stomach guts and how both arise from a presupposition that an intelligence is leaving messages.
Comment by don provan — January 26, 2009 @ 4:09 pm
January 26th, 2009 at 4:22 pm
You're confusing yourself. These symbols convey a message. The message is there whether you read it or not. Your thoughts, pertinent to a stomach gut, are a product of your mind. There is nothing intrinsically symbolic about a gut. There is something intrinsically symbolic about the letters used to convey this message.
Comment by Bradford — January 26, 2009 @ 4:22 pm
January 26th, 2009 at 4:41 pm
Bradford:
Many people believed (some even believe to this day) that there is a message in the specific pattern of entrails dropped onto the ground. What makes you think that what they see is not "intrinsically symbolic"?
Comment by Raevmo — January 26, 2009 @ 4:41 pm
January 26th, 2009 at 4:45 pm
Raevmo:
I don't know what they see but if you can name the symbols and show the mappings perhaps I can better respond.
Comment by Bradford — January 26, 2009 @ 4:45 pm
January 26th, 2009 at 4:48 pm
Bradford:
I don't know either. Maybe it helps if you explain what you mean by "intrinsically symbolic" (as opposed to other forms of symbolic).
Comment by Raevmo — January 26, 2009 @ 4:48 pm
January 26th, 2009 at 7:56 pm
What I mean is that a coding convention already exists mapping symbol a to x etc. I can think of entrails (ugh) and assign them any meaning I wish in my mind but this is not an encoding convention (except perhaps to me).
Comment by Bradford — January 26, 2009 @ 7:56 pm
January 27th, 2009 at 12:23 am
I had a chance to glance over the paper Tom Clark provided with his comment. Here are a few my initial criticisms:
First, in general, though this is a relatively recent paper, these are the same tired old arguments. Low in any effort to really understand what the other side (my side) really thinks and is really trying to say, but high in the use caricature, ridicule and pejorative arguments to create the straw men that Fishman then easily dispatches. The problem with all this is that good logic does not rely on fallacious arguments. And this paper is simply full of fallacious arguments. In my opinion, fallacious arguments reveal weakness under the pretense of strength. The arguments don't fool anyone except those who already agree with the arguments.
For example, in another rehash of ‘who designed the designer?” argument Fishman decides to quote philosopher Thomas Nagel apparently thinking that his argument was strong enough to stand on its own. But is it?
Nagel writes:
“…it is surely incongruous to postulate a first cause as a way of escaping from the coils of an infinite series. For if everything must have a cause, why does not God require one for His own existence? The standard answer is that He does not need any, because He is self-caused. But if God can be self-caused, why cannot the world itself be self-caused? (Nagel, 1959, p. 7)”
What theologian teaches that God is self caused? I’m not familiar with any? In fact, most theologians I know about argue that self causation is a self contradictory concept. In other words, this is nothing more that a straw man. The easiest way to topple a straw man is to challenge the critic to produce a real man (or woman) who holds exactly the same view as that of the straw man. Know any?
He also rehashes Richard Dawkins “the complexity of God argument” without mentioning the rebuttal by Alvin Plantinga. Okay, maybe he is ignorant of Plantinga’s rebuttal. Or, maybe he figures that the best way to deal with a good argument is to simply ignore it. But then again, maybe it’s because his remarks are meant for the “choir”, and God forbid that the choir should ever be exposed to a good argument. Afterall, we want them to remain good little free thinkers and even free thinkers can become confused.
And then there is this:
“Some philosophers have argued that science presupposes a naturalist metaphysics on the grounds that the practice of science would be impossible if supernatural explanations are allowed (Mahner and Bunge 1996a,b). However, Naturalism is not a premise or presupposition of science – it is a conclusion of science, albeit a tentative one, based upon the available evidence to date.”
What is Fishman really saying here? It sounds like to me he is saying “no we shouldn’t bring a a naturalistic metaphysic into science." Okay, I'll agree with that. But then what he shuts out the front door he turns around and tries to smuggle in through the back door. But the he tries to explain that naturalism is the logical conclusion of science, but only tentatively (Huh?) You mean it is an inconclusive conclusion? Sounds to me like Fishman wants his metaphysical cake and eat it too… but only tenatively. (Sorry, I know that’s a cliché but so are most of Fishman’s arguments.)
Comment by JOHN_A_DESIGNER — January 27, 2009 @ 12:23 am
January 27th, 2009 at 5:59 am
JAD
I tried to reply to your post last night (UK time), but it got lost. Trying again…
While I will agree that naturalism excludes an enduring (after death I assume) self or soul, I am curious why Goetz and Taliaferro claim that, for example, there can be no teleological explanation of me eating my dinner in naturalism. Exactly why is feeedom of will impossible without invoking a supernatural agent or component?
Why do you think that a supernatural agent or component is a necessary requirement for that?
I am happy to have a go at explaining the first within a naturalistic framework, but only if you can explain it within your theistic framework first. You describe this as a "conviction", so I assume you are sure of your position, and have this well thought out. I musty admit I am only a tentative naturalist, so I will be winging it to some extent, but hopefully, if you are willing, we can have a good discussion.
Comment by The Pixie Again — January 27, 2009 @ 5:59 am
January 27th, 2009 at 6:20 am
JAD:
Is it really? From the Wiki page on Causa sui:
I read somewhere else that Descartes uses the "fact" that God is the only self-caused entity to "prove" that God must exist.
Comment by Raevmo — January 27, 2009 @ 6:20 am
January 27th, 2009 at 10:50 pm
Raevmo quoting Wikipedia:
There is a distinct logical difference between something that is supposedly self caused and something that is uncaused. For something to cause itself it must necessarily precede itself. Clearly that involves a contradiction because something cannot exist before it exists. On the other hand, where is the contradiction with the idea that something has always existed? Atheists, for example, have traditionally argued that universe along with matter/energy and the laws of nature are eternal and therefore uncreated.
Raevmo:
So, so far you can’t provide me the name of even one theologian (Descartes is considered a philosopher and mathematician, not a theologian, even if he said what you claim he said.) However, I honestly think that there must be someone out there who believes in causa sui. But even if you find someone that person is hardly representative of modern, or even pre modern, theological thinking.
Comment by JOHN_A_DESIGNER — January 27, 2009 @ 10:50 pm
January 27th, 2009 at 11:47 pm
Pixie:
Actually, in the strict sense it is not logically necessary. After all, there could always be some explanation “x” that no one yet understands that can explain our free will. What I think intelligent agency (it need not be supernatural) provides is an explanation for why consciousness and intelligence even exists. How did the unconscious forces of nature cause consciousness and mind to come into existence? I think this is a baffling mystery and remains unexplained.
I think “consciousness expert” David Chalmers said it best when he wrote in his book, The Conscious Mind, that’ “Consciousness is a surprising feature of our universe. Our grounds for belief in consciousness derive solely from our experience of it. Even if we know every last detail about the physics of the universe—the configuration, causation, and evolution among all the fields and particles in the spatial temporal manifold—that information would not lead us to postulate the existence of conscious experience. My knowledge of consciousness in the first instance comes from my own case, not from any external observation. It is my first-person experience of consciousness that forces the problem on me.” (p101,102)
By the way, I believe Chalmers is a non-Theist, so his approach is some what different than mine, but I like a lot of what he says because he is asking the right questions.
You wrote:
Okay, give it your best shot.
Comment by JOHN_A_DESIGNER — January 27, 2009 @ 11:47 pm
January 28th, 2009 at 12:09 am
You claimed the argument was bogus unless someone believes it, so Raevmo gives evidence that it's a known position. Then you change the goalposts by saying even if a few people believe it that doesn't matter? Or that the people who believe this don't meet your criteria for being a 'theologian'? You're using the old cliche argument, "if you don't agree it's because you don't understand how sophisticated modern theology is." Tom's argument still holds even if you substitute 'always existed' for 'self-caused'. If God can always exist then why can't the universe always exist? You even mention that some atheists claim this, so apparently you know the parallel exists and are simply playing word games.
Comment by Todd Berkebile — January 28, 2009 @ 12:09 am
January 28th, 2009 at 12:14 am
So the cause of intelligence is intelligence? I guess you believe in Causa Sui after all.
Evolution.
Comment by Todd Berkebile — January 28, 2009 @ 12:14 am
January 28th, 2009 at 12:45 am
Todd B,
John had said:
What theologian teaches that God is self caused? I’m not familiar with any? In fact, most theologians I know about argue that self causation is a self contradictory concept. In other words, this is nothing more that a straw man.
Raevmo's response was a link to a very short wikipedia entry that mentions traditional western theism God is either self-caused or uncaused. He thinks he may have heard Descartes give an argument along those lines – otherwise, wikipedia lists Spinoza.
You're misrepresenting what John said, along with the weight of what Raevmo's source provides. From my reading of Aquinas, Augustine, the scholastics, even Aristotle, yes – the notion of 'self-caused' is regarded as incoherent. God is viewed as uncaused, eternal, unchanging overwhelmingly in those views. And one reason 'uncaused' is favored over 'self-caused' is because 'self-caused' is regarded as incoherent. Someone may disagree – philosophy is like that – but it hardly matters in this context.
For one thing, because the universe is (apparently) contingent, and arguments attempting to demonstrate otherwise are lacking. Do you know what contingent means? Probably not, because you're pre-emptively ranting about how someone is going to talk about how sophisticated 'modern theology' is, without realizing that these arguments aren't exactly new.
Comment by nullasalus — January 28, 2009 @ 12:45 am
January 28th, 2009 at 1:00 am
Ah, a perfect example. Hollow arguments about necessity and contingency are a great example of theological sophistry. Why, I'm obviously just not smart smart enough to understand the brilliance of it, otherwise certainly I would agree with you. Tom's argument still holds if you replace 'self-caused' with 'necessary' too.
PS: I see you have backpedaled on the line I quoted while I was writing my response. You can say arguments against contingency are weak, but I can just as easily say arguments for necessity are weak.
Comment by Todd Berkebile — January 28, 2009 @ 1:00 am
January 28th, 2009 at 1:23 am
Todd B,
Yes, Todd – only theologians discuss necessity and contigency. Certainly not philosophers in general, or atheists. Unless they're secretly in league with the theologians.
It's all part of the big conspiracy, you see.
Of course not – I had already went back and edited what I said to reflect the nature of these debates. I doubt you would agree with me, because as I said I suspect you're not too clear on what contingency even is. The fact that you've got nothing but bluster here is just backing that up.
The 'argument' quoted is…
For if everything must have a cause, why does not God require one for His own existence? The standard answer is that He does not need any, because He is self-caused. But if God can be self-caused, why cannot the world itself be self-caused?
First, there's no argument here – at best it's a suggestive question. There's not much holding here either – there's no proof that the universe exists necessarily, no disproof that God exists. Better arguments in both directions can be found, if you were the type to actually read about these things in venues other than 'Pithy line someone made a web banner out of'.
By all means, demonstrate that the universe exists necessarily. Offer up some arguments. In the end, the best responses usually come down to 'Well, if I imagine enough – maybe by way of throwing out causality, or proposing a supernatural something-but-somehow-not-God, maybe I can kinda imagine a possibility. Or I can punt, say no one knows or can know, but insist we shouldn't entertain certain possibilities anyway.' And that's fine – philosophy is rarely (some would say never) conclusive. But when the best options on the table are 'magic', 'the Godlike but somehow not really God', or 'I don't know, but I don't like where this is going', it's not that impressive.
Comment by nullasalus — January 28, 2009 @ 1:23 am
January 28th, 2009 at 5:59 am
JAD
Okay. Looks like this is an issue we agree on: The mind may or may not have a supernatural aspect/component.
Right. And "x" could be supernatual, such as the soul, or it might not. we have no way of knowing.
If I understand this right, one scenario, then, would be God, the intelligent agency, causing consciousness and intelligence to exist? I.e., any intelligence requires intelligence to engender it.
So is it "turtles all the way down", or is there some point at which an intelligence does not require another intelligence to cause it? Is that ultimate intelligence necessarily supernatural, or could there be a naturalistic explanation? If the latter, then why should we not suppose that human intelligence has a naturalistic cause? I am going to guess you go for the former.
I think so too. That does not lead me to invoke (or reject) supernatural causes. How about you?
Sounds like Chalmers is a dualist – as am I, and I presume you too.
Sure. Right after you do.
I will be honest with you; I very much doubt you have such an explanation. However, should you produce something, I will just copy-and-paste, and substitute "soul" with "emergent property of the brain", and see how that looks. It is my conviction that the soul explains nothing, but is useful in explaining away plenty. I think "emergent property of the brain" will be every bit as good at explaining away as the soul is. But we can see how it goes.
Comment by The Pixie Again — January 28, 2009 @ 5:59 am
January 28th, 2009 at 6:55 am
As an aside, the Pixie v JAD discussion does a good job of highlighting why I think 'supernatural v natural' is a confused waste of time.
Which isn't to the detriment of either person. JAD I admire and often agree with, and Pixie is one of the most civil people I disagree with who contributes to TT. But 'the emergent property of the brain can do everything the soul can do! and the soul doesn't explain anything, it explains it away' is… well, everyone else can figure it out.
At the end of the day, the only considerable difference between strong 'emergent property' claims and 'dualist' claims of substance or most any other stripe is that the former is supposed to no longer be around once the matter is gone, while the latter's activity is not supposed to be discernible while still existent in the same case.
In which case, 'the emergent properties of the brain' may as well be 'supernatural' for purposes of discussion. It's like asserting naturalism by positing Aristotilean final causes at work in nature. Sure, I suppose you can argue it's naturalism. Which just goes to show how little value that word has.
Comment by nullasalus — January 28, 2009 @ 6:55 am
January 28th, 2009 at 10:50 am
Tom's 'argument' switched to necessity:
For if everything must have a cause, why does not God require one for His own existence? The standard answer is that He does not need any, because He is 'necessary'. But if God can be necessary, why cannot the world itself be necessary?
You can argue about the definition of 'argument' all you want, but Tom's statement seems equally clear and valid when self-caused is switched to 'uncaused' or 'necessary'. Can you answer his question or will you merely point out that other people can answer his question?
Ah yes, once again I'm just not smart enough to understand. Or course you continue to offer no explanation yourself nor do you offer any description of what you think contingency means. I guess that makes your post equally blusterous. Since all you have said is 'arguments for contingency exist' all I need to say to remain on par with your content is that 'arguments against contingency exist and counter arguments to god-by-necessity exist but I guess you just aren't familiar with them.'
This is what you fail to understand, my argument is not for or against any particular explaination. My argument is simply that these necessity arguments work just as well if you replace god or 'first intelligence' or whatever with 'the universe,' much as in Pixie's soul-verse-emergent property example. You go on to point out these arguments about necessity are not all that impressive, and I agree that they aren't. Necessity based arguments for god are just complicated attempts to define god into existence. And these arguments remain equivalent when the supernatural is replaced with the natural.
Comment by Todd Berkebile — January 28, 2009 @ 10:50 am
January 28th, 2009 at 12:56 pm
Thanks Todd. You've made a good argument for Intelligent Design being distinct from religion.
Comment by Bradford — January 28, 2009 @ 12:56 pm
January 28th, 2009 at 5:35 pm
nullasalus
I sort of, kind of, agree with you. My point was that "emergent property" is every bit as convincing and as effective at explanation as invoking the soul. With the resourse available, we cannot tell between them. However, there is a fundamental difference, which is that JAD has a conviction that there is something that will survive the death of the body, while I think probably not. I think that as we know more about the brain, so we will know more about the mind tht emerges from it (I guess JAD disagrees). I think in a century we may well have evidence one way or another.
Comment by The Pixie Again — January 28, 2009 @ 5:35 pm
January 28th, 2009 at 6:18 pm
Todd
Because unlike the world God (if he exists) is necessary by definition in fact one shorthand definition of God is “that which is necessary“.
You could claim that the world is necessary by definition but to do so is to claim that the world is God and such a claim requires evidence.
Peace
Comment by fifth monarchy man — January 28, 2009 @ 6:18 pm
January 28th, 2009 at 6:35 pm
fmm:
Wow. What is a longhand definition of God?
So anything that is necessary is God? What's your evidence for that claim?
Is it possible for something to be necessary and not be God?
Comment by Raevmo — January 28, 2009 @ 6:35 pm
January 28th, 2009 at 7:21 pm
One way or the other? I see how we might learn enough to conclude the mind does emerge from the brain, but I'm not as sure we'll be able to have evidence for a soul even if we never find any evidence for emergence.
Comment by don provan — January 28, 2009 @ 7:21 pm
January 28th, 2009 at 7:35 pm
Raevmo
Personally I like
That of which nothing greater can be conceived.
Here’s an oldie but a goody from 1644
That one being whose subsistence is in Himself; whose essence cannot be comprehended by any but himself, who only hath immortality, dwelling in the light, which no man can approach unto; who is in Himself most holy, every way infinite, in greatness, wisdom, power, love, merciful and gracious, long-suffering, and abundant in goodness and truth; who giveth being, moving, and preservation to all creatures.
Because that is the definition of God. does a person need to give evidence that gas is gaseous?
Nope because if there was somthing that did not depend on God for it's existance then God would not be "that of which nothing greater can be conceived."
This is a logical contradiction akin to saying “gas is not gaseous”
simple stuff really
peace
Comment by fifth monarchy man — January 28, 2009 @ 7:35 pm
January 28th, 2009 at 7:35 pm
Raevmo
Personally I like
That of which nothing greater can be conceived.
Here’s an oldie but a goody from 1644
That one being whose subsistence is in Himself; whose essence cannot be comprehended by any but himself, who only hath immortality, dwelling in the light, which no man can approach unto; who is in Himself most holy, every way infinite, in greatness, wisdom, power, love, merciful and gracious, long-suffering, and abundant in goodness and truth; who giveth being, moving, and preservation to all creatures.
Because that is the definition of God. does a person need to give evidence that gas is gaseous?
Nope because if there was somthing that did not depend on God for it's existance then God would not be "that of which nothing greater can be conceived."
This is a logical contradiction akin to saying “gas is not gaseous”
simple stuff really
peace
Comment by fifth monarchy man — January 28, 2009 @ 7:35 pm
January 28th, 2009 at 7:37 pm
Thank you for proving my point that 'arguments from necessity' are little more than fancy ways to define god into existence. I guess despite how stupid null knows I am I managed to get something right.
Again since the whole argument is just about defining god into existence but not about showing god to have any specific properties you could, in fact, say 'the world is god.' There are an infinite number of definitions for ‘god’ by which I would accept that god exists. If you define god to be Pad Thai then not only do I think god exists but I had god for lunch today. These definition games do not imply that god is intelligent, conscious, benevolent, or like anything defined in any ancient texts.
Comment by Todd Berkebile — January 28, 2009 @ 7:37 pm
January 28th, 2009 at 7:48 pm
But don't you realize how many human value judgments you made in your definition? Consider the value judgments in the definition of god you listed above:
whose essence cannot be comprehended by any but himself: Why is being incomprehensible a good thing? Why isn't it just as good if not better to be simple?
who only hath immortality: What makes living forever inherently better than being mortal?
dwelling in the light, which no man can approach unto: What makes being unapproachable a good thing? I prefer a leader who is both approachable AND has weekly press conferences which he posts to youtube.
every way infinite: So why is size everything? Is this some male phallic insecurity issue?
long-suffering: And how is his suffering a benefit over not having needed to suffer?
who giveth being, moving, and preservation to all creatures. But wouldn't he be even better if he gave us life instead of just leasing it to us? If all these qualities make god so wonderful then he would have been even more wonderful had he imparted these same qualities to his creation.
You definition is just a laundry list of human value judgments. How could a human thinking something is better than something else compel god to have that quality?
Comment by Todd Berkebile — January 28, 2009 @ 7:48 pm
January 28th, 2009 at 8:00 pm
fmm:
Conceived by whom? Can God not conceive of anything greater than herself?
Comment by Raevmo — January 28, 2009 @ 8:00 pm
January 28th, 2009 at 8:11 pm
Todd B,
I didn't argue about it, Todd – I simply pointed out that there's not much argument there. As for the question, I did answer it – I also pointed out that the philosophical arguments typically resolve nothing definitive in either direction. Their value lies elsewhere.
Good God. I thought you worked with computers for a living.
'All you need to do' is use a search engine (using the amazing, wonderful machine in front of you) on "the universe is contingent" or "the argument from contingency" or even look up the word "contingency" at the right resource to figure out what contingency is, or even read up on these arguments – which I said exist in both directions – if you cared to learn. Instead you're digging in your heels and trying your best to think of a way to say 'Well, uh, you're the one blustering!' Good luck with that.
As with Pixie – the result of that is to utterly deplete the value and meaning of 'natural', or at least to show the lack of value in the term. By all means, go for it – going to those lengths only builds up the theist's case by exposing the core of 'naturalistic explanations'.
Further, I said the arguments about necessity – in either direction – don't settle all that much. Welcome to philosophy. But they can serve purposes without giving definite conclusions: By illustrating what (some/most) theists are picturing with regards to God, and illustrating that the evasions of the arguments have a religious component themselves. Theism/deism only seem like a stretch until one starts considering the alternatives.
Comment by nullasalus — January 28, 2009 @ 8:11 pm
January 28th, 2009 at 8:21 pm
nullasalus:
The alternatives are obviously not-theism/deism. But to understand what that means, you need to define your god. So let's hear it.
Comment by Raevmo — January 28, 2009 @ 8:21 pm
January 28th, 2009 at 8:30 pm
Todd
If that is true then nothing can be conceived that is better than Pad Thai. Everyone knows that barbeque ribs are better.
Seriously you don’t believe that Pad Thai is better than love or existence itself do you?
Is unintelligent better than intelligent? Unconscious better than Conscious? Malevolent better than benevolent?
God is not incomprehensible, only incomprehensible to lesser beings that’s what it means to be the greatest.
God is simple. That’s also part of the definition.
God is approachable just not approachable by lesser beings unless he wants to be. That’s what it means to be greatest.
To be infinite is to be beyond size that's what it means to be the greatest.
Who said he needs to suffer? It’s not part of the definition I gave
Part of being the greatest is not being able to create something as great as yourself. A unkillable creature can not exist if God exists. That's what being the greatests means.
Because that’s the definition of God. It’s possible god does not exist but if he does he must correspond to his definition
Simple logic
peace
Comment by fifth monarchy man — January 28, 2009 @ 8:30 pm
January 28th, 2009 at 8:34 pm
Raevmo
anyone
nope
Comment by fifth monarchy man — January 28, 2009 @ 8:34 pm
January 28th, 2009 at 8:53 pm
Raevmo,
Actually, the alternatives are 'claimed to be not-theism/deism, but so similar in every way that it's silly to take that stance', 'not-theism by granting conditions to the universe so extensive that deism(s) are practically guaranteed', 'hell if I know, it's a freaking mystery, but I know it's not theism/deism', etc beyond mere asserted atheism.
And, define 'my God'? Sorry, I'm making a grander claim than that – I'm not arguing that my Catholicism is a better, more reasonable explanation than atheism. I argue that Christianity writ large, Islam, mormonism, deism, hinduism, Plato's demiurge, Aristotle's Uncaused Cause, etc – wildly disparate views as they are – at core are less of a stretch than atheism. If you want to compare and contrast, by all means, let me know what explanation of the universe and existence you subscribe to.
Comment by nullasalus — January 28, 2009 @ 8:53 pm
January 28th, 2009 at 9:07 pm
If she could then that being would be God instead
peace
Comment by fifth monarchy man — January 28, 2009 @ 9:07 pm
January 28th, 2009 at 9:08 pm
These are definitions given by someone that doesn't want to define anything. After all, nothing about these "definitions" suggests worship or religion or prayer or any of the other things that are, of course, fundamental to what anyone means when they use the term "God".
Comment by don provan — January 28, 2009 @ 9:08 pm
January 28th, 2009 at 9:17 pm
So your definition of god is whatever the best thing we can imagine is. Well, someone with all the properties you mention but who also posts a weekly podcast to YouTube would be even greater! I just checked YouTube, no video's from god. Therefore I guess I've proved god doesn't exist by using your necessity claims.
Comment by Todd Berkebile — January 28, 2009 @ 9:17 pm
January 28th, 2009 at 9:44 pm
Todd
Someone who could instantly communicate to anyone he chose to with out being restricted to broadband would obviously be even greater. I could go on all day and bigger brains than us have been known to.
Give it up Todd you can't win this one
peace
Comment by fifth monarchy man — January 28, 2009 @ 9:44 pm
January 28th, 2009 at 9:50 pm
I took my definition from a Confession of faith put together specifically for
quote;
for the vindication of the truth and information of the ignorant;
End quote:
It contains specific directions for worship etc. worship is about your response to God not about what he is
peace
Comment by fifth monarchy man — January 28, 2009 @ 9:50 pm
January 28th, 2009 at 10:07 pm
Someone who both could do that and also routinely did that with all his creation would be even greater. God hasn't called me yet, guess I proved he doesn't exist again.
Regardless, I think making a permanent weekly record available to everyone via YouTube is greater that simply having some instant one-on-one communication ability that you don't use with everyone. Who's to say your judgement of which is greater controls what god must be rather than mine?
Starring in the Matrix would be great. Winning the most academy awards would be great. Being logically consistent would be great. So now god must be all of Keanu Reeves, Katharine Hepburn, and logically consistent! And you know, I consider being myself to be the greatest thing posible, so I guess god would also have to be me in order to exist! Or is it somehow necessary that your opinions about what is greater than what are more important than mine?
Comment by Todd Berkebile — January 28, 2009 @ 10:07 pm
January 28th, 2009 at 10:20 pm
Worship is pointless unless "God" is listening. The definitions you gave doesn't suggest any such thing.
But, of course, neither of your definitions imply existence, and that doesn't appear to bother you, either.
Comment by don provan — January 28, 2009 @ 10:20 pm
January 28th, 2009 at 10:33 pm
God does
Oh yes he has (Romans 1:20) so no you haven't
making your constant communication so obvious that those who claim to not have heard it come off as foolish would be even better. Again I could go on all day. You can't win this one
Because your “judgment’ is either the picture of a selfish idolatrous being unworthy to be called God or a juvenile attempt to prove he does not exist. Either way it is not God because a greater being can be conceived.
Not at all we are not talking about opinions but what can be conceived these are two very different concepts
Peace
Comment by fifth monarchy man — January 28, 2009 @ 10:33 pm
January 28th, 2009 at 10:44 pm
DP
Can a being who is in
“every way infinite, in greatness, wisdom, power, love, merciful and gracious, long-suffering, and abundant in goodness and truth” not listen to the prayers of creatures who honestly seek after him? I think not
Lots of smart folks think that my definition makes his existence necessary A god who exists would definitely be greater than one who does not. Don’t you agree?
Peace
Comment by fifth monarchy man — January 28, 2009 @ 10:44 pm
January 28th, 2009 at 10:51 pm
Now you are the one providing proof god doesn't exist, thanks.
You are dancing around the root issue that everything you are spewing are simply value judgements from human minds. Why would god be defined by any particular human's specific value judgements? If human value judgements change about what is greater than what change, does this change god to match?
Not opinions? What, you have some sort of 'greatness' meter to compare these various propositions? How many greatness units does a weekly YouTube broadcast generate? Please tell me how you judge the relative greatness of two properties without resorting to opinions.
Comment by Todd Berkebile — January 28, 2009 @ 10:51 pm
January 28th, 2009 at 10:55 pm
Why? Perhaps it is greater to be a perfect idea than to truly exist in a universe where perfection might not be possible. Why can't I conceive an idea greater than what is possible? How many greatness units does existence grant? How do you prove that existing is greater than not existing?
I've already conceived of several ways god might be even greater than you define him just in this thread.
Comment by Todd Berkebile — January 28, 2009 @ 10:55 pm
January 28th, 2009 at 11:07 pm
Because a God that made all created beings so that their deepest longings would correspond to his attributes would be greater than one who did not
They don’t change only their conception of them does. For example I once thought that my life could not be better but then I had a son and realized that I had not thought about it deeply enough
No
Less than one i.e. less than the greatness of God
I just ask my self if a greater being can be conceived and if it can your judgments fail to make the grade
Off to bed
peace
Comment by fifth monarchy man — January 28, 2009 @ 11:07 pm
January 28th, 2009 at 11:11 pm
Absolutely.
You're joking, aren't you?
Oh, I get it: God is just an idea. That makes sense, although it has no practical use. Definitely no point in worshipping an idea, for sure.
Comment by don provan — January 28, 2009 @ 11:11 pm
January 28th, 2009 at 11:12 pm
Ideas exist don't they?
off to bed
Comment by fifth monarchy man — January 28, 2009 @ 11:12 pm
January 28th, 2009 at 11:15 pm
Why? Why wouldn't an even greater god make beings without deep longings? Buddhists think an absence of longing is an increase in greatness. How does stacking one more value judgement on top of the stack of value judgements prove that the entire stack is valid?
Huh? In other words you use your a prior opinions to prove that your opinions aren't opinions? You are highly circular.
Comment by Todd Berkebile — January 28, 2009 @ 11:15 pm
January 28th, 2009 at 11:17 pm
Please explain how
You are unaware of the ontological argument?
Comment by fifth monarchy man — January 28, 2009 @ 11:17 pm
January 28th, 2009 at 11:44 pm
Pixie wrote:
First of all, where in my comments have I used the word soul? Generally I like to use less archaic terms like consciousness or self or mind. Are you saying that you are going to explain away the idea of a conscious self? Are you a conscious self or am I talking to an illusion?
There are some strict naturalists like Susan Blackmore who actually think that the idea of a personal self, including for themselves personally, is an illusionary one. In one of her articles she writes: “ I long ago concluded that there is no substantial or persistent self to be found in experience, let alone the brain. I have become quite uncertain as to whether there really is anything it is like to be me.” (Talk about an identity crisis.) So do you think that my conviction that my self is real is mistaken. It can simply be explained away as the accidental functioning of my brain. Do you think that my immediate awareness of myself is supernatural?
When I originally wrote that I had a conviction, “That I have free will, and that I am free moral agent who is responsible for his moral choices.” I wasn’t thinking about the afterlife or God or anything miraculous I was thinking more in epistemological terms. Like Descartes (cogito ergo sum) I was trying to begin the discussion with the kind of knowledge that I personally am most certain of. That knowledge is of me. I can doubt the world exists; I can doubt that God exists; but the one thing that I can’t doubt and don’t doubt is that there is something called me, or myself, or my personal self that really exists. I thought that would be something that is universally understood. So who do you agree with more? Susan Blackmore or me?
Comment by JOHN_A_DESIGNER — January 28, 2009 @ 11:44 pm
January 29th, 2009 at 8:18 am
JAD
You fiollowed your convictions with the question: "How does strict naturalist explain my 2 convictions? Naturalism is a rejection of the supernatural; that led me to conclude that you were invoking the supernatural in both your convictions. Perhaps you meant something different by "naturalism"; if so, the I have no idea what.
Your second conviction ended: "this purpose and meaning transcends what I observe out there in nature; to me this reads like a purpose outside nature; the supernatural, or more specifically God.
I apoligise for misunderstanding you, but hopefully you can see why I did so. Perhaps you could clarify what you did mean.
So as far as I can see, you answer your own question; your explanation is a naturalistic explanation. And I am happy to agree with it.
I Googled Blackmore, and found a very interesting article by her. As far as I can see, her claim is that our perception of consciousness is not how cobnsciousness reeally is, thus our perception of it is an illusion. I think she still believes we do have a consciousness: "When I say that consciousness is an illusion I do not mean that consciousness does not exist. I mean that consciousness is not what it appears to be."
How can you be certain that you have free will (I have to confess, I am not too sure what free will is)? How do you know that your life has a purpose that transcends what you observe in nature? How can you be more sure of that than of the existence of the world?
On the question of whether the consciousness self exists? I think we all agree that it does.
Comment by The Pixie Again — January 29, 2009 @ 8:18 am
January 29th, 2009 at 8:20 am
Now that is a theological question. If you were an honest Buddhist and this was a theological forum I would be happy to engage it, as it is it is completely beside the point because Buddhists agree with me that God is necessary by definition.
Once again value judgments are not the same thing as comprehension. I can comprehend many things that I don’t value.
I can easily comprehend a God that is infinite in holiness but since I’m a sinner I don’t value such a God.
We are all circular Godel proved that. The difference is my circle begins and ends with a necessary thing (God) and yours begins and ends with a contingent thing (Todd)
Peace
Comment by fifth monarchy man — January 29, 2009 @ 8:20 am
January 29th, 2009 at 8:22 am
nullasalus:
nullis in verba, nullasalus.
Since when is atheism an "explanation" of anything? I'd say that atheism is the logical result of refusal to subscribe to ill-defined entities, such as your fantasy Holy Trinity.
Comment by Raevmo — January 29, 2009 @ 8:22 am
January 29th, 2009 at 8:52 am
Raevmo,
Typical atheist dodge – 'Don't ask us to explain anything! Even though an explanation is implicit based on what we insist can't be true!' You only want to discuss if you can criticize – Dawkins forbid you defend your alternative.
Though I can't blame you for not standing up for the atheist FSM. It doesn't wear well.
Comment by nullasalus — January 29, 2009 @ 8:52 am
January 29th, 2009 at 10:20 am
Um, huh? Buddhists agree God is necessary? Apparently you aren't well versed in Buddhism. I'm sure there are specific Buddhists that accept god as necessary (I've known Buddhist Christians) but it is certainly not a part of Buddhist dogma.
And once again you the dodge the issue that your argument is very intentionally nothing more than a pile of opinions. You also seem to fail to understand what I mean by value judgment. I never equated this to comprehension. Any declaration that some particular value of some particular property is 'greater' than any other possible value of that property is a value judgment. Any declaration that some specific property is or is not in the set of 'greatness determining properties' is a value judgment. The word 'greater' is being used as a subjective measure in your argument.
The argument from necessity leads to one of two results, either:
a) You end up defining a god which quite clearly doesn't exists. It is trivial to conceive of a greater god by addition of another property which by definition god must be the greatest at, for example greatest NFL player.
b) You must spend the rest of time justifying why your opinions are more correct than the next guys opinions and why only properties that cannot be objectively verified apply to 'greatness'.
Since you have yet to discount the numerous examples of properties for which god is clearly not the greatest (he hasn't won a Nobel Prize, a NFL championship ring, or a Pulitzer) then it seems you are currently in condition 'a' where you have defined a god which clearly does not exist.
Comment by Todd Berkebile — January 29, 2009 @ 10:20 am
January 29th, 2009 at 1:39 pm
By ignoring them. Obviously a being that can ignore prayers is more perfect than one that cannot.
I've just never run into anyone that took it seriously.
Comment by don provan — January 29, 2009 @ 1:39 pm
January 29th, 2009 at 6:56 pm
nullasalus:
You have a funny view of atheism. The only thing that unites atheists is a disbelief in deities. I think science explains quite a bit, so I would never say 'don't ask me to explain anything'. It's part of my job to explain stuff to students. Perhaps you mean 'don't ask us to explain everything'. I have no problem admitting that I don't know what, if anything, caused the universe to exist, or how life originated. I am critical of claims that "the designer did it" without any evidence, and that's what I like to discuss here.
Comment by Raevmo — January 29, 2009 @ 6:56 pm
January 29th, 2009 at 7:12 pm
Actually for the Buddhist as I understand it ‘Nirvana” and the ‘universe’ is “God” in that it is unconditioned. All other things are conditioned. Again If you were a honest Buddhist I would explore further what you meant by Nirvana but at the very least I believe it is unconditioned ie not contingent.
I know. On the other hand my definition is about comprehension so unless you can equate value judgment to comprehension it has nothing to do with my definition.
Of course it’s subjective if it’s you or me who are doing the comprehending but my definition requires that God be the greatest being that can be comprehended (by anyone) therefor it is objective
You still don’t get it. A being who does not need to play football is obviously greater than an NFL player. Simple logic
Again we are not talking about opinions we are talking about comprehension they are not the same thing.
Its my opinion that the greatest NFL player would be cool but I can easily comprehend a still greater being. Even if I could not someone somewhere could comprehend a greater being
What are you talking about ?
A being who did not need to do any of those thing would obviously be greater than one who does. It’s simple logic use you head for a minute.
Peace
Comment by fifth monarchy man — January 29, 2009 @ 7:12 pm
January 29th, 2009 at 7:20 pm
DP
Comment by fifth monarchy man — January 29, 2009 @ 7:20 pm
January 29th, 2009 at 8:07 pm
No, I disagree completely. Listening to prayers means giving those praying preferential treatment. The perfect God would be maximally loving, merciful, and gracious to all regardless of whether they prayed.
Indeed, listening to prayers in and off itself makes God less than perfect since prayers from imperfect beings will contain imperfect information that can only reduce His otherwise perfect knowledge.
Comment by don provan — January 29, 2009 @ 8:07 pm
January 29th, 2009 at 8:45 pm
Why? This is completely NOT obvious and in fact requires justification. By your logic I am greater than all NFL players because I don't need to play football either! So part of your proof of god absurdly 'proves' I'm better than everyone who has ever played in the NFL. It's just your opinion that 'NFL stardom' is not a property that contributes to god's greatness. Its not about comprehending what an NFL player is or comprehending what makes an NFL player great or comprehending other properties that might also contribute to greatness. God could be all those other properties you mention PLUS be the greatest NFL player thus increasing his greatness. You'd have to show why being in the NFL would specifically decrease god's greatness in order to claim this property doesn't apply to god's necessity. The argument from necessity just runs around in absurd circles like a headless chicken.
Comment by Todd Berkebile — January 29, 2009 @ 8:45 pm
January 29th, 2009 at 8:52 pm
To quote William of Ockham (famous for his razor):
“For nothing ought to be posited without a reason given, unless it is self-evident (literally, known through itself) or known by experience or proved by the authority of Sacred Scripture.”
Works for me.
Comment by Rob R. — January 29, 2009 @ 8:52 pm
January 29th, 2009 at 9:00 pm
DP
Why? In order for preferential treatment to be given God would need to do more than just listen he would need to modify his behavior as a result of said prayer would he not? God does as he pleases prayer is a way for creatures to acknowledge his sovereignty over our lives not manipulate his emotions
He is. Prayer is not a act that has merit in God’s eyes
God does not gain information from prayers instead humans gain………….peace
Comment by fifth monarchy man — January 29, 2009 @ 9:00 pm
January 29th, 2009 at 9:10 pm
Do all NFL players need to play football? Come on Todd use your head.
I never said it would decrease God's greatness God the Holy Sprit through his presence in the body of NFL players is an NFL player. You just don’t get this whole omnipresent thing do you ?
However needing to be a football player would decrease his greatness.
peace
Comment by fifth monarchy man — January 29, 2009 @ 9:10 pm
January 29th, 2009 at 9:10 pm
You admit humans are flawed and imperfect. Our hearts and minds are corrupt. And god's mind knows all about us and this knows the corruptness within us. This means our corruption is a part of god. A more perfect god could not know or contain such corruption. So a more perfect god could not have created something corruptible in the first place. Merely creating us would diminish god's greatness.
Comment by Todd Berkebile — January 29, 2009 @ 9:10 pm
January 29th, 2009 at 9:19 pm
I say it would increase his greatness to be the best NFL player, you simply fail to comprehend. Your attempt to define god as having been the greatest NFL player by virtue of 'being all everything' could define god into existence, but it doesn't leave room for free will. The greatest NFL player must be the greatest by virtue of his free actions or else he's not really responsible for his greatness. So merely tagging along incorporeally is not enough to credit god as the greatest NFL player, I'm afraid. So if god is the greatest NFL player then humans have no free will and since humans commit unholy acts god would be responsible for those too. A greater god would likely have never created such unholy creatures as we find on earth anyway.
I didn't say he needed to be, but he would happen to be. Just like he doesn't need to hear the prayers but does here them he doesn't need to play football or win a noble prize but he would have.
Comment by Todd Berkebile — January 29, 2009 @ 9:19 pm
January 29th, 2009 at 9:34 pm
This is true unless our corruption served to enhance his greatness by allowing him to exercise his Wrath Grace and Justice to the maximum extent give up Todd you can’t win this one
Depends on how you define free will. I’m a Compatibilist so it’s not a problem for me at all. I guess that means I win by your own admission.
peace
Comment by fifth monarchy man — January 29, 2009 @ 9:34 pm
January 29th, 2009 at 9:49 pm
What's the difference between "not modify his behavior" and "ignore"? You're just confirming that God, as defined by you, will ignore prayers, which was my point.
He needs his sovereignty acknowledged? That seems exceedingly imperfect. Even I don't have that imperfection.
So there's no reason to pray, is there?
What humans gain is, of course, immaterial to what God is. You seem to have forgotten that you were objecting to my claim that your definitions don't suggest a reason to pray, yet now you are just coming up with reasons to pray having nothing to do with your definitions.
If God listens, he gets information. That's what "listen" means.
Comment by don provan — January 29, 2009 @ 9:49 pm
January 29th, 2009 at 9:59 pm
Ah, so now being slightly corrupt is defined as being more great than being uncorrupt.
A perfect example of my claim that the argument from necessity is just complex sophistry. Only by a prior acceptance of the desired conclusion can you measure the optimal 'greatness' value for any given property. The whole thing is a circle argument, a begging of the question. By this logic a brain surgeon could increase his greatness by bashing someone's head in only to then apply their skills to save the person's life. By this logic it might increase god's greatness to deliberately commit evil in order to show off his mercy. Also by this logic, god apparently has a need to demonstrate his 'Wrath Grace and Justice' and clearly a superior god would not have this need. Your giant stack of opinions seems really wobbly from where I'm looking.
I win just by showing how ridiculously convoluted and circular the argument from necessity is and how the same reasoning leads to absurd conclusions. Showing this is my objective. The more epicycles you pile on top of your definition the more obviously absurd it is.
Oh? I thought compatibilists believed free will and determinism could both co-exist, not that a single act could be both deterministic and also be free? Am I mistaken?
Comment by Todd Berkebile — January 29, 2009 @ 9:59 pm
January 29th, 2009 at 10:06 pm
DP
What ?
Ignore means not pay attention to, and for God not to modify his actions means to do always do what is best which is after all what Christians always pray for
“thy will be done” remember
No but I need to acknowledge it
It would be if God had that need. He doesn’t
Since it is good for me to acknowledge his sovereignty God is meeting my need by allowing such acknowledgement.
Are you even paying attention?
By praying I gain peace I need peace so there is reason to pray
What? My definition reveals that God is the greatest thing and prayer is simply an acknowledgment that I’m not.
What?
listen
1. make conscious effort to hear: to concentrate on hearing somebody or something We listened for the sound of the geese overhead.
2. pay attention: to pay attention to something and take it into account She wouldn't listen to my advice.
Peace
Comment by fifth monarchy man — January 29, 2009 @ 10:06 pm
January 29th, 2009 at 10:18 pm
The objects of his wrath do just that. Those who have experienced his mercy on the other hand can’t continue to sin it’s not in our nature.
God does not have a need to demonstrate his 'Wrath Grace and Justice' but we have a need to see it.
Yes
peace
Comment by fifth monarchy man — January 29, 2009 @ 10:18 pm
January 29th, 2009 at 10:30 pm
What? My definition remains exactly the same as at first. Yours on the other hand has shifted several times. from football player to Budda to cosmic liberterain freewill giver.
It might be better to find one false god and stick with him as it is you seem to be desperately grasping at straws.
peace
Comment by fifth monarchy man — January 29, 2009 @ 10:30 pm
January 29th, 2009 at 10:49 pm
A superior god would have so much mercy that it would be impossible for anyone not to experience it. So if even one person has failed to experience his mercy then a better god could be conceived. You accept that some people sin thus some people haven't experienced god's mercy. Thus a greater god can be conceived.
I'm curious, how exactly does that work? On the surface those terms are opposites so by simply tautology a single thing cannot be both. I can certainly see that if you think 'true == false' that would explain the logic of your arguments.
Comment by Todd Berkebile — January 29, 2009 @ 10:49 pm
January 29th, 2009 at 10:51 pm
Your definition is piling up more and more a prior justifications for why certain properties contribute to greatness and other properties don't.
Comment by Todd Berkebile — January 29, 2009 @ 10:51 pm
January 30th, 2009 at 12:13 am
Pixie wrote:
Notice I specifically used the term strict naturalists, a term that Stewart Goetz and Charles Taliaferro use in their book and yes I think strict naturalists (unlike naturalists like David Chalmers) do have a problem with purpose, meaning and free will. For example Richard Dawkins writes: “The universe we observe has precisely the properties we should expect if there is at the bottom, no design, no purpose, no evil and no good, nothing but blind, pitiless indifference… DNA neither knows nor cares. DNA just is. And we dance to its music.” (from River out of Eden) Obviously Dawkins doesn’t believe that we have anything like free will.
But lets follow the logic out here a little. You’re spending your time writing to me. Are you doing that by your own free will? You have been spending part of your time challenging some of my thinking. But why? If I have no free will and you have free will then what’s the point? I think the way I do because that has been determined by my genes and you think the same way you do for the same reason. It’s even more ironic with someone like Dawkins. It seems logical to me that something as pervasive religion is genetically determined so why condemn people for what only comes naturally? So How does Dawkins interpret something like free will? Obviously from his perspective “free will” is an illusion.
Well, like I said free will is a conviction. A conviction whether it’s religious or not is something that is deeply personal, deeply internalized belief that becomes a strong motivation for the way we live and act. However, I can’t give you a logical proof that my conviction is true. All that I know is that it is my conviction. Who was it that admonished us “ know thyself”? Was that Socrates?
However, I must confess that I am quite surprised by your questions. I was assuming, perhaps naively, that if these convictions of mine were not universally accepted at least they would be understood as something that most people believe in. I guess our culture has drifted further from its roots than I thought.
Because I own my own thoughts. I don’t own the world. Maybe this is where the word soul needs to come into play. It was Jesus who said: “What shall it profit a man if he should gain the whole world and lose his own soul?” I was thinking about paraphrasing this verse and substituting the word self for soul but soul just seems to be more appropriate here.
For some reason I couldn’t follow your link so I googled an article by Blackmore that I thought looked relevant and therefore might be the one you were reading. Here is how she concludes her article entitled “There is No Stream of Consciousness“:
“I asked at the outset 'What is all this? What is all this stuff – all this experience that I seem to be having, all the time?'. I have now arrived at the answer that all this stuff is a grand illusion. This has not solved the problems of consciousness, but at least it tells us that there is no point trying to explain the difference between things that are in consciousness and those that are not because there is no such difference. And it is a waste of time trying to explain the contents of the stream of consciousness because the stream of consciousness does not exist.”
When I was growing up in USA there this game show called “What’s My Line” in which three different people would claim to be a person who did something or invented something (etc.) significant. However only one of the people was that person. A panel would question the guest to try to determine if he/she really was that person. Of course at the conclusion of the show the host would say: “Now, will the real (persons name) please stand up.” I guess that’s a good question to ask Susan Blackmore.
Comment by JOHN_A_DESIGNER — January 30, 2009 @ 12:13 am
January 30th, 2009 at 12:38 am
Hi Pixie,
Long time no talk. Hope all is well in your world.
Without getting to technical as to the why, if we substitute "self" will for "free" will maybe the term free ( self) will has more explanatory power. Just a suggestion
How do I know I have free ( self ) will? To deny "self" I must first affirm "self" in order to deny it. Therfore it is undeniable that I have "self" will. That which is undeniable must be true. Thats my position anyway
Vivid
Comment by Vividbleau — January 30, 2009 @ 12:38 am
January 30th, 2009 at 7:43 am
JAD
I am not convinced that Dawkins does not believe in free will. From here:
Even if he did, does he speak for or represent all strict naturalists?
In what way are strict naturalists different to any other naturalists? To me, naturalism is the rejection of the supernatural; do strict naturalists reject it completey, but the other naturalists only reject some supernatural things? I think not.
Sure, some naturalists reject free will. Others do not.
I wonder if reductionist might be a better word in this context than naturalist. Chalmers is a non-reductionist, but is still a naturalist. Or perhaps we should say monoist; Chalmers is (I think) a dualist, but is still a naturalist.
Apparently for him it is not.
Everything I do, I do for a reason. It may be a trivial reason, it may be a bad reason, but there is always a reason. Did you have any reason for writing your posting? If you did (and I presume you did), then where does free will come in? I ask this, not to argue against free will, but to try to understand what it is.
Okay, so long as we both agree you have no firm evidential grounds for your convictions, then I think we have no argument.
I am left wondering at your question: "How does strict naturalist explain my 2 convictions? Given your own inability to explain your convictions, why do you ask for an explanation from naturalism (or reductionism, or monoism or whatever?
I thought the atheism vs theism debate revolved (in part) around the question of whether life has meaning and purpose beyond what we give it ourselves. That said, perhaps you meant something different by "transcends nature"? Could you clarify?
That is the one. She rejects the "stream of consciousness" – which is what the article is about – but not consciousness itself.
Comment by The Pixie Again — January 30, 2009 @ 7:43 am
January 30th, 2009 at 8:15 am
I think you have grossly misinterpreted our conversation let me illustrate with a story
Little Todd: What is the Grand Canyon?
Teacher : It’s the structure with more volume than any other in the world
Little Todd: My toy box must be the grand canyon because it holds more toys than anything else in my house
Teacher :NO the Grand Canyon can contain millions of toy boxes
Little Todd: My school must be the grand canyon because it can hold more people than anything else in our town
Teacher :No the grand canyon can contain millions of schools like yours
Little Todd: My TV must be the grand canyon because it contains all my favorite shows
Teacher : No the grand cannon can contain millions of TVs just like yours
Little Todd: The grand canyon clearly does not exist because you keep piling on prior justifications why my suggestions are not it.
Teacher : Youre a dope
Comment by fifth monarchy man — January 30, 2009 @ 8:15 am
January 30th, 2009 at 8:25 am
You are showered with God’s mercy every moment of your life in that you are allowed to continue to keep breathing his air. The fact that you refuse to acknowledge the source of that air is a deficiency on your part not His
I wont do all your work for you but here
peace
Comment by fifth monarchy man — January 30, 2009 @ 8:25 am
January 30th, 2009 at 11:03 am
fmm:
You analogy fails to match this conversation. Your analogy concerns a conversation about the value of a single property. This discussion has centered on the complete exclusion of specific properties. For now I am willing to accept any value of any property that you propose so long as you can explain why some properties are in the set of ‘greatness imbuing properties’ and other properties, most notably all objective properties, are apparently not in that set. A better analogy would thus be:
fmm: God is the entire alphabet.
Todd: Is god B?
fmm: No, god is A, B is not in the alphabet.
Todd: Is god C?
fmm: No, god is A, C is not in the alphabet.
…etc etc etc ad nausea…
Your definition of god is that he is the greatest at every possible property. So far other than a desire to match your a priori conclusions you have given no justification for why this excludes the various properties I have mentioned. I have mentioned both objective properties (NFL skill) and metaphysical properties (undeniable mercy, unavoidable mercy). By your argument either god must excel at all these properties or he doesn’t exist. Unless, of course, you can explain by any means other than circular dependency on your a priori conclusion how to determine what properties contribute to greatness and what properties don't.
Comment by Todd Berkebile — January 30, 2009 @ 11:03 am
January 30th, 2009 at 2:23 pm
So there is no point.
No, I don't remember. In fact, I recall specifically that nothing about "thy will be done" was either in or implied by your definitions.
Not according to the definitions you gave.
Are you paying attention? The definitions for God that you gave say nothing about needing or attaining peace. Your efforts to achieve peace have nothing to do with what you're proving exists via the perfection argument.
So that's you: you think you need to acknowledge that. We've already established that your pefect being doesn't need you to acknowledge that. According to your own definitions of "God", an atheist that doesn't feel any need to acknowledge will be in exactly the same position as someone practicing a religion.
Your definition of "listen" simply supports what I'm saying: there's no need to listen unless you don't know what the geese sound like. Not knowing what the geese sound like or what any given human might be expressing via prayer is an imperfection. That's true even if we hadn't already agreed above that praying is pointless, since a perfect God will always do what it best no matter what we pray.
The bottom line is clear: even if we accept the completely unfounded basis that existence is more perfect than non-existence — every single example we've ever encountered is exactly the opposite: the non-existent ideal is always closer to perfection that any actual example — the quality of perfection inherently makes religions pointless vis-a-vis God. As your examples show, given a perfect God, the only reason for religion is to satisfy people's needs. Ironically, those needs and the ways religions satisfy them do not depend on the existence of God or on God being perfect. So from both angles, your definitions are disconnected from any concept of God actually involved in any religion.
Comment by don provan — January 30, 2009 @ 2:23 pm
January 30th, 2009 at 2:38 pm
Why is it a deficiency on his part? A need to acknowledge the source of that air seems more like a deficiency.
Comment by don provan — January 30, 2009 @ 2:38 pm
January 30th, 2009 at 2:50 pm
Little Todd: What kind of F'ing answer is that? The Pacific Ocean takes up almost half the world, so is that what you mean?
Teacher: No, because the Pacific Ocean has water in it.
Little Todd: But the Grand Canyon has water in it, doesn't it?
Teacher: The water in the Grand Canyon is perfect. The water in the Pacific Ocean is imperfect.
Little Todd: I want a different teacher.
Principle: You're fired.
Comment by don provan — January 30, 2009 @ 2:50 pm
January 30th, 2009 at 6:45 pm
Tom Clark writes:
The paper by Fishman that he cite states:
Fishman doesn’t think it is merely questionable – he thinks it is wrong.
Do the critics here think the supernatural can be included in science? Do the critics here agree with Fishman that the Dover decision contains a flawed rationale?
Comment by MikeGene — January 30, 2009 @ 6:45 pm
January 30th, 2009 at 7:08 pm
What? ‘Thy will be done” is the appropriate response to a God that meets my definition not what God is I think you are loosing it?
What are you talking about? Prayer is the response to God not what he is? Does you definition of science include your admiration for it?
What are you talking about? I’m not proving anything exists let alone tying my peace to God’s existence. I’m merely giving the definition of God which includes the concept of necessity. I even made it a point of saying that God is only necessary if he exists
This was all in response to Todd’s bold assertion that the world had just as much a claim to necessity as God did .
I’m not trying to convert you Don you can relax.
Right being finite is a deficiency that all creatures share. To refuse to acknowledge that need is to compound finitude with foolish pride.
Teacher That's not what I mean and you know it.
By volume I meant free space If you did not understand all you had to do was ask
If you can't give others at least the benifit of the doubt. you will never make it in the first grade.
peace
Comment by fifth monarchy man — January 30, 2009 @ 7:08 pm
January 30th, 2009 at 7:28 pm
The Pixie,
That's less evidence that Dawkins believes in free will and more that Dawkins is wildly inconsistent and tends to say whatever has the right rhetorical appeal. You only need go as far as his talk about the 'Basil Fawlty beating his car' rationale of treating people as if they had control over their actions to see as much.
And once we're at this stage it becomes clear that 'naturalist' and 'supernatural' are very empty words. A naturalist is then little more than someone who rejects God and any explanations they think require or imply God. Supernatural is derisive word for any explanation they reject out of hand based on those grounds. Other than that, they can have whatever view they want about the world – rife with design and designers, dualist or monist, etc.
But the outcome is that it makes appeals to science meaningless in the context of that discussion. The naturalist doesn't offer a real view of reality – they'll just call anything they think science indicates 'natural', no matter how strongly in accord with a non-naturalist perspective it may be. Rupert Sheldrake has supernatural explanations of things, unless somehow he turns out to be right. In which case, hooray for Rupert Sheldrake for providing a natural explanation of things.
Pixie, do you really exist? Are you the same Pixie who posted the other comments in this thread under that name?
If yes, wonderful – you apparently disagree with Blackmore. You can do that, you know.
If no – or if you're unsure (It depends on what 'exist' means, how can you be certain, etc), why should anyone discuss anything with you? There is no 'you', and therefore no entity who can contain reason and rationality, much less an argument.
Comment by nullasalus — January 30, 2009 @ 7:28 pm
January 30th, 2009 at 8:31 pm
An assertion which, by the way, you have still failed to address.
Comment by Todd Berkebile — January 30, 2009 @ 8:31 pm
January 30th, 2009 at 8:50 pm
Todd:
What part of
Because unlike the world God (if he exists) is necessary by definition
don't you understand?
Consider the following sentence for a clue
Gold is just as likely to be gaseous as a gas is.
Do you get it now?
Comment by fifth monarchy man — January 30, 2009 @ 8:50 pm
January 30th, 2009 at 9:03 pm
Pixie wrote:
Okay then, let’s cut to the chase. Imagine a scene where rescuers are digging through the rubble of a house that has just been totally destroyed by a tonado. While a couple of rescuers are moving one of the walls they notice a board game with its pieces strewn on the floor beneath them . At first they don’t pay much attention. Then one of the notices, “Hey there is a message written there” Sure enough there is a neat row of scrabble pieces with the message: IN THE BEGINNING WAS THE WORD.
Who wrote it? How did it get there?
Now I think that there are three basic possibilities:
A. The message , which is a quote form the Gospel of John, is of supernatural origin.
B. The message is the result of some intelligent agency. (For example, the humans that occupied the house just before the storm.) Or,
C. The message is the result natural forces. The tornado,
perhaps?
Now, I think most people would reject C not only as highly improbable, but just plain silly.
How is that any different from the sequences that we find coded in DNA. If you claim that it got there naturally, you should be able to rigorously explain how. Why? Because you like most naturalists claim that your views are based on empirical science.
I might not be able to give detailed explanation either, but I still think logical inference leads to some kind of intelligent agency rather than any kind of natural causality.
Consciousness, mind and free will. Are they more or less complex that coded sequences?
Dawkins: (from the interview) “I am very comfortable with the idea that we can override biology with free will. Indeed, I encourage people all the time to do it. Much of the message of my first book, "The Selfish Gene," was that we must understand what it means to be a gene machine, what it means to be programmed by genes, so that we are better equipped to escape, so that we are better equipped to use our big brains, use our conscience intelligence, to depart from the dictates of the selfish genes and to build for ourselves a new kind of life which as far as I am concerned the more un-Darwinian it is the better, because the Darwinian world in which our ancestors were selected is a very unpleasant world. Nature really is red in tooth and claw. And when we sit down together to argue out and discuss and decide upon how we want to run our societies, I think we should hold up Darwinism as an awful warning for how we should not organize our societies.”
I stand corrected. (sort of) Apparently, Dawkins does in some sense believe in free will. But then that really mystifies me more. It suggests that ruthless determinism is the cause of our free will. Does he still believes that the human mind result of an unguided, undirected evolutionary process? Does he give an explanation how mind came from mindlessness? How free will is the result raw determinism?
Here’s how Dawkins answers those questions in the interview:
“So forget all about genes and think entirely about the philosophy of determinism. Now, everybody who calls themselves a determinist knows subjectively that they have the sensation of free will. We all know what it feels like to feel free. The only argument is whether fundamentally we are determined. That's one position which I wouldn't mind taking up. I don't find any difficulty with that position. I am quite prepared to believe that when I think I've taken the decision — when I feel that I, with my own free will, have exercised a free choice, I've decided to do one thing rather than another — I've decided to immigrate or decided not to immigrate, or to buy this house rather than that house — it feels like free will. But it's perfectly possible that actually my decision to immigrate or not to immigrate was influenced by events in the brains which were influenced by other events, influenced by other events, which fundamentally all have a definite physical cause.”
From my reading Dawkins seems to be claiming that Free will is more likely an illusionary subjective feeling. I don’t think he is claiming that free will is real. Like nullasalus, I think he is using some rhetorical sleight of hand to make his views more palatable to the general public.
I’ll try to get to some of your other questions later.
Comment by JOHN_A_DESIGNER — January 30, 2009 @ 9:03 pm
January 30th, 2009 at 9:13 pm
You haven't said why I can't simply define the universe as being necessary just as you simply define god as being necessary. You merely state this would make the definition of god and the definition of the universe the same, but why does the universe care if god has the same definition? Heck, I even think the universe is more perfect than your stack-of-opinions god because the universe can create beings more intelligent than itself. That is clearly a greatness.
Comment by Todd Berkebile — January 30, 2009 @ 9:13 pm
January 30th, 2009 at 9:17 pm
fmm:
I also await your response as to how we decide what properties contribute to god's greatness and what properties do not. Your definition of god is that he is the greatest at every possible property. So far other than a desire to match your a priori conclusions you have given no justification for why this excludes the various properties I have mentioned. I have mentioned both objective properties (NFL skill) and metaphysical properties (undeniable mercy, unavoidable mercy). By your argument either god must excel at all these properties or he doesn’t exist. Unless, of course, you can explain by any means other than circular dependency on your a priori conclusion how to determine what properties contribute to greatness and what properties don't. I'm really hoping you can get past this horrific problem so we can move on to some of the other excellent reasons why the argument from necessity fails.
Comment by Todd Berkebile — January 30, 2009 @ 9:17 pm
January 30th, 2009 at 9:44 pm
That's not my definition if you still don't know my definition after I have repeated it over and over it tells me you are not listening.
If you are not even listening to what I say why should I bother to respond?
That's why the teacher called little Todd a dope
Comment by fifth monarchy man — January 30, 2009 @ 9:44 pm
January 30th, 2009 at 10:14 pm
fmm,
If you're going to deny your ontological argument, then I guess we're done.
Comment by don provan — January 30, 2009 @ 10:14 pm
January 31st, 2009 at 9:29 am
It’s all about the argument for you isn’t it DP
By the way it’s not my argument and I'm not denying it. You're not much on listening either are you?
Comment by fifth monarchy man — January 31, 2009 @ 9:29 am
January 31st, 2009 at 11:58 am
fmm,
Awww, giving up already? Admitting you can't specify what properties contribute to greatness and perfection by any non-circular means? If you cannot know what properties a necessary god has and what properties he doesn't have then simply saying 'something exists that I have defined to be god' is a very weak statement. In fact this statement tells us nothing.
I was really hoping you would find a way past the 'begging the question' fallacy so we could discuss some of the other failings of the argument. Oh well, if history shows us anything this issue will likely pop up again sometime.
Comment by Todd Berkebile — January 31, 2009 @ 11:58 am
January 31st, 2009 at 12:30 pm
Or perhaps FMM is tired of dealing with people who think something along the lines of 'Is God a pizza? My pizza is pretty awesome, so I guess God is like the most awesome pizza, right?' is a good response to the ontological argument.
And I'm not a big fan of it. But the argument at core is damn old, has puzzled a number of detractors (Have a look at what Bertrand Russell, of all people, has to say about it), and seems to have value whether or not someone necessarily buys that particular proof.
Though I admire the hell out of FMM for attempting to explain it to a hostile audience. As ever, the guy has more patience than I do.
Comment by nullasalus — January 31, 2009 @ 12:30 pm
January 31st, 2009 at 1:00 pm
My whole point is the argument is so patently absurd that it leads to ridiculous conclusions like 'god is the perfect pizza.' There is a standard response to that particular absurdity, I was hoping FMM would spit out the standard response so we could move on to the other weaknesses of the argument. I guess neither of you are well enough versed in the argument to parrot out the standard reply.
By the way, Bertrand Russell (at various points in his life) would agree with me that the argument is absurd. He discusses Aquinas', Leibniz's and Kant's objections to the argument in History of Western Philosophy.
Comment by Todd Berkebile — January 31, 2009 @ 1:00 pm
January 31st, 2009 at 1:15 pm
And he also started off being utterly convinced by it. From the Stanford Encyclopedia of Philosophy: "However, as Bertrand Russell observed, it is much easier to be persuaded that ontological arguments are no good than it is to say exactly what is wrong with them."
In other words, Russell knew it wasn't so simple to demonstrate the supposed absurdity. Which is why it's still kicking around to this day. You are aware that this is an argument with many formulations, yes?
Yes, Todd – anyone can all look this up in wikipedia and see how they summarize a common philosophical argument, then parrot what they probably don't grasp to begin with. Parroting from googled resources – that's what these discussions are to you? As I said, FMM has vastly more patience than I do.
I'm no fan of the ontological argument, at least in terms of it persuading people – which is why I've been content to stay out of this, funny as it's been to watch. I just popped in to express admiration for FMM, and advising that it's not nearly as simple as people tend to think. Stanford's got a nice entry on it – if someone is really curious about what's going on with this argument, I'd recommend that entry at a starting point.
I have a feeling no one really is.
Comment by nullasalus — January 31, 2009 @ 1:15 pm
January 31st, 2009 at 1:28 pm
I was not following these exchanges closely but this prompted another look. From much earlier:
'Necessary' is used within a causal context.
In this case God would be specified as the initial first cause in a causal chain. That's consistent with God's attributes.
Necessity is a means of analyzing causal arguments including the no God one. If the causal chain is infinite we have a rationally incomprehensible concept. If it is not we have a first cause whose attributes must match the requirements of succeeding events in the causal chain. Or we are left with a logically unsatisfying and causally vapid existential explanation- it just is.
Comment by Bradford — January 31, 2009 @ 1:28 pm
January 31st, 2009 at 2:58 pm
Mike Gene:
The overwhelming response is deafening.
Comment by Bradford — January 31, 2009 @ 2:58 pm
January 31st, 2009 at 3:25 pm
JAD
First of all, naturalism does not claim that we can "rigorously explain" everything. For one thing, this is patently not tru; there are all sorts of these that remain unexplained in science.
So how is the natural explanation, B, different to invoking ID to explain the message in DNA?
(1) The message is in English, a language that we know has meaning to intelligent agents. In DNA the message is in codon, a language known to be "understood" by biochemicals in the cell.
(2) There is a well-known intelligent agent that had the opportunity to write the message. We know people are intelligent, capable of writing messages and many are sufficiently familiar with the English language that they can readily produce messages in it. There is no evidence to support the claim of the existence of a designer of the DNA message.
(3) These intelligent agents are well-known to be around at approximately the right time and place.
(4) Many of these intelligent agents place a high degree of significant in this specific message.
(5) The message was written in a medium that was itself know to be manufactured by these intelligent agents. We have no reason to suppose DNA was built by an intelligent agent.
(6) There is no established or proposed mechanism that might explain how the message can come about though either supernatural or non-intelligent means. On the other hand, we do know that the message in DNA can get reproduced and modified without intelligent input.
All these things point to a natural intelligent agency for your hypothetical message, but not for DNA.
I have no idea how you would go about determining that.
Of course, because you and null have a stereotype of what a materialist is supposed to believe, Dawkins is the archetypal materialist, so clearly he is lying when he says anything to upset your stereotype.
This is especially odd as you objected when I said you were proposing a supernatural component to the mind, i.e., the soul. You seemed earlier to accept the possibility of dualism without requiring a soul. So here is Dawkins, accepting consciousness and free will, but rejecting the soul. Why do you now disagree with that position? What am I missing here?
Comment by The Pixie Again — January 31, 2009 @ 3:25 pm
January 31st, 2009 at 3:29 pm
Mike
The supernatural has no place in scientific explanations.
However, any phenomena, supernatural or not, can be studied with scientific methodology. Afterall, how would you know whether it was supernatural?
Comment by The Pixie Again — January 31, 2009 @ 3:29 pm
January 31st, 2009 at 3:56 pm
The Pixie,
Aren't you the person who regularly insists that no one really believes in materialism anymore anyway? And why do you think this is some ignorant stereotype, and not the result of actually reading what Dawkins writes?
At least in my case, I'm rejecting him because he really does seem to be contradicting himself. Or playing a game where he's defined 'free will' in such a way that it's meaningless.
Here's Dawkins on free will. A choice extract:
But doesn't a truly scientific, mechanistic view of the nervous system make nonsense of the very idea of responsibility, whether diminished or not? Any crime, however heinous, is in principle to be blamed on antecedent conditions acting through the accused's physiology, heredity and environment. Don't judicial hearings to decide questions of blame or diminished responsibility make as little sense for a faulty man as for a Fawlty car?
By this writing, he doesn't even have a compatiblist notion of free will. Agents are not responsible for their actions, full stop. They are machines, and should be regarded as (even treated) as such. If this is a statement of belief in free will, what would a rejection of free will look like?
Comment by nullasalus — January 31, 2009 @ 3:56 pm
January 31st, 2009 at 3:58 pm
So, there we have it. The supernatural can only be investigated if it turns up false. If it seems true, it gets classified as 'no known solution' or something thereof.
Comment by nullasalus — January 31, 2009 @ 3:58 pm
January 31st, 2009 at 5:59 pm
Pixie:
So it is based on faith then? How then is it a better explanation than theism?
“Understood?” Why can’t naturalists ever make an argument without using anthropomorphism? Biochemicals don’t understand anything. Natural selection doesn’t know anything. What kind of content am I suppose to load into “understood”? Or in other words, how am I to understand what you mean by understood?
Does that mean then an intelligent agent couldn’t be the creator of the messages we find in DNA? Am I to assume that a prioi?
For example, consider the following DNA sequence:
CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG
TCTAAAACTGGGAGTTGATAAGGGTCTGCAATTAGA
I know for a fact that it was an intelligent agent created the message. I encoded the verse (John 1:1) that I quoted above, using a simple substitution code. So in principle an intelligent could encode any message he wanted. In fact, Richard Dawkins makes that suggestion in, The Blind Watchmaker. Ironically, he suggests that we could easily encode the entire New Testament in some of the so called junk regions of DNA that make up the human genome.
The point I am trying to make is that if we know that an intelligent agent could genetically encode DNA, why not at least consider that a possibility?
But that assumes that you have some kind of cellular organism with the potentiality of both evolvability and adaptability. How did the first DNA or RNA messages get formed in the first cells or replicators? Explain how unintelligent, unguided natural processes can create functionally meaningful code sequences that can eventually evolve into beings like you and me? Once again is it impossible that the DNA code is the result of an intelligent agent?
If a coded sequence can be created by a mind then I think it is obvious that whatever it is made of is at least capable of performing more complex processes than what it creates.
Ditto Nullasalus about my views of Dawkins.
Comment by JOHN_A_DESIGNER — January 31, 2009 @ 5:59 pm
January 31st, 2009 at 6:34 pm
nullasalus
And still people ignore me. Thus, when I am guessing what they think, I assume they think "materialism".
It is really a shame you did not include his next sentence:
Sounds to me like he is reaching a philosphical conclusion, and then admitting that he (and everyone else) does not accept that point as true, despite its obvious logic. He believes that logically we should reject free will, but nevertheless he still believes in it. You can call that contradictory if you want – I will not argue with you – but that does leave him believing in free will.
Bingo!
Comment by The Pixie Again — January 31, 2009 @ 6:34 pm
January 31st, 2009 at 6:58 pm
JAD
Certainly not in the religious sense, no!
For me, I regard naturalism as the default position. Occam's razor basiclly says the simplest explanation is the best, and to me the simplest explanation is the one that does not have to invoke extraeous supernatural entities (the cause of thunder would be a classic example of the success of that). i have never experiences the supernature, I have never seen any convincing evidence for the supernature, I have never found anythng explain better by invoking the supernatural – or indeed explained at all, rather han merely explained away.
The better explanation is the one that is correct, is it not?
I think you will find pleny of arguments by naturalists that do not use anthropomorphism, even on TT.
That would be why I put the scare-quotes around the word. I was comparing the message on the board game, with the supposed-message in DNA. One is understood by people, the other is "understood" (and please notice the scare-quotes this time) by biochemicals. Of course, it is not really understood, but then, it is not really a message, is it? It is just a string of chemicals.
(2) There is a well-known intelligent agent that had the opportunity to write the message. We know people are intelligent, capable of writing messages and many are sufficiently familiar with the English language that they can readily produce messages in it. There is no evidence to support the claim of the existence of a designer of the DNA message.
"Message?" Why can't IDists ever make an argument without using anthropomorphism?
This is all about weighing the probabilities. When you find a message in English, on a gaming board, you look at the probability of it being done by the wind, or the probability of it being done by a fellow human, who can speak English. On balance, I would say the latter was far more probable. When considering the origins of life, we have a much harder time estimating probabilities, but we can still weigh the various factors.
Okay, I will consider it. Now what? I have no problem with ID in principle. As a fan of science fiction, I think it would be amazing to find that Mike Gene is correct, and life on this planet was seeded by aliens. The funny thing is that such a finding would have hardly any effect on this debate. Mike's theory would be an addition to modern evolutionary theory, but natural selection, variation and macro-evolution would still be in there. Of course, the creationists would still reject the new modern evolutionary theory, because it stil posits man as related to monkeys, and there would still be no God in it. They would just have to relabel it again.
I will agree that it could hve been the result of an intelligent agent. Will you agree with me that it might not?
Still not getting that, but in my view the mind (along with the whole body) was itself created fromn a coded sequence. How does that impact on your argument?
Comment by The Pixie Again — January 31, 2009 @ 6:58 pm
January 31st, 2009 at 8:35 pm
The Pixie,
Sounds to me like you've had it clearly demonstrated to you that Dawkins is utterly inconsistent on the subject of free will, and you're down to some pretty bizarre rationalizations in order to ignore that point.
Between this and your conversation with JAD, it's clear that your whole 'I'm just a tentative naturalist/atheist/what-have-you!' schpiel is little more than song and dance. You have conclusions you want to reach, you'll twist however you can to get to them, then plead that you're just following the evidence. I'd criticize that, but it's about par for the course as far as naturalism goes, so…
Comment by nullasalus — January 31, 2009 @ 8:35 pm
February 1st, 2009 at 6:37 pm
nullasalus
Okay. How does that help your argument?
Okay, I guess you have made up you mind already.
Comment by The Pixie Again — February 1, 2009 @ 6:37 pm
February 1st, 2009 at 9:15 pm
Pixie:
Certainly, that is a logical possibility. But, I am comparing possibilities. Naturalists commit themselves apriori to a position that our biosphere, including mankind, is all the result of unguided and undirected natural forces without plan or purpose. If that is true, then at the very least you should be able to give me a detailed description of how the initial DNA or RNA strands were encoded using only the natural processes that existed in the environment of the early earth. Furthermore, this sequence has to be complex enough to create a replicator that can, not only survive, but, evolve in a hostile environment. Please note that nature, if there is no agent around to direct it, has to somehow “know” without “knowing” how to do all this. If you can’t give me such description then you should concede that this is something that’ at least at present’ cannot be explained naturalistically. Or, you should direct me to some authoritative source who can.
For me it is not simply a question of possibility, it is one of sufficiency. I doubt that nature is sufficient in and of itself to explain the origin of life, or the origin of consciousness and mind.
Comment by JOHN_A_DESIGNER — February 1, 2009 @ 9:15 pm
February 2nd, 2009 at 5:41 am
JAD
And theists commit themselves apriori to a position that it is all created (in a general sense) by God. I would guess that, in general, the naturalists are more open-minded than the theists. Naturalists seem to take naturalism as the default position due to a lack of evidence for God, the soul, etc., and so would seem to be more set up to change, if that evidence becomes available. Evidence that there really was an all-loving God could only be good news.
On the other hand, most theists have a life commitment to their religion, in terms of attending services, praying, etc., and so, I think, would have a much deeper commitment to their position. The realisation that actually there is no all-loving God, there is no afterlife, would by far more troubling.
So while I will accept that there is that commitment by naturalists, I think this is rather more of an issue for theists.
And I am sure that you, as a theist who has an apriori position that God created the universe, can give a similar detailed description of how the initial DNA or RNA strands were encoded by God.
Sure, I will concede that at present it cannot be explained. I am hopeful it will in my lifetime, though. Do you expect a detailed mechanism for how God encoded DNA in that time frame?
Interesting opinion. For me, it is the total lack of evidence for the existence of any intelligent designer with the capacity to do it, but that is just my opinion, of course.
Comment by The Pixie Again — February 2, 2009 @ 5:41 am
February 2nd, 2009 at 7:08 am
Pixie to JAD:
The unsurprising conclusion of a non-theist.
More accurately, the evidence does not fit in with their worldview and their worldview is not likely to change.
But an all loving, yet all knowing God, could not tolerate morality by consensus. That in turn would require surrendering one's personal sovereignty to God insofar as moral standards are concerned.
As a naturalist and champion of empiricism why not give us the natural version of why laws of chemistry generate encoded nucleic acids. It would be unsurprising that one would not know the mind of God except as it would be revealed to us but, knowing nature requires observation and analysis. When this comes up empty then so too do claims for the exclusivity of naturalist approaches.
Comment by Bradford — February 2, 2009 @ 7:08 am
February 2nd, 2009 at 12:23 pm
Bradford
So you judge the truth-value of a statement by how surprising it is? As arguments go, that is pretty pasthetic, Bradford.
Are you going to claim it is any different for Christians? Do you think a Christian would be more ready to abandon his faith if good evidence turned up for naturalism (or for Hinduism or Islam).
Is your faith strong, Bradford? If it is, you cannot claim to have an open-mind. Tricky question (or trick question, if you like), which of course you will dodge, rather than lose a point to the evil atheists, because either way you lose. If you have an open-mind, your faith is weak. If your faith is strong, your mind is closed.
For myself, I am happy to admit only a very weak "faith" in atheism/naturalism; hence, I feel able to claim an open-mind.
I already believe in absolute morality. A god who enforces it would be excellent news indeed. If only there was some reason to believe in such a thing besides wishful thinking.
The observation and analysis is on-going, Bradford, and science gets ever closer to at least a possible answer (I will freely admit we may never know if it is the right answer). Another gap slowly closes.
Comment by The Pixie Again — February 2, 2009 @ 12:23 pm
February 2nd, 2009 at 2:50 pm
You don't have a clue as to what biblical faith really entails. It has little to do with the questions that come up in blogging. But God is interested in whether or not a rich man cheats the government out of more than 100,000 dollars and "repents" only to get a cabinet position in the new adminsitration. Faith is about whether or not you do the right thing when only God is looking.
Comment by Bradford — February 2, 2009 @ 2:50 pm
February 2nd, 2009 at 3:04 pm
Bradford wrote:
Interesting. I personally find it more impressive when people do the right thing when no one is looking.
Comment by olegt — February 2, 2009 @ 3:04 pm
February 2nd, 2009 at 3:13 pm
Faith is about whether or not you do the right thing when only God is looking.
God is always looking.
Comment by Bradford — February 2, 2009 @ 3:13 pm
February 2nd, 2009 at 3:20 pm
Bradford:
What made you choose that example? I guess it's already a sin to be a Democrat.
It's so comforting to know that God is interested. He must have been very interested in the Holocaust too. Too bad he couldn't be bothered to do something about it. But then, most of the victims were headed for hell anyway I suppose, so why intervene?
Comment by Raevmo — February 2, 2009 @ 3:20 pm
February 2nd, 2009 at 3:31 pm
But God is interested in whether or not a rich man cheats the government out of more than 100,000 dollars and "repents" only to get a cabinet position in the new adminsitration.
Nah. Only a crooked one. I thought this administration was dedicated to integrity in government. Not a good choice in that regard.
Comment by Bradford — February 2, 2009 @ 3:31 pm
February 2nd, 2009 at 3:37 pm
Bradford:
He confessed, repented and was forgiven. Sounds like the Catholic thing to do. Why, come to think of it, the Church just reinstated a Holocaust-denier who only repented after public outrage.
Comment by Raevmo — February 2, 2009 @ 3:37 pm
February 2nd, 2009 at 3:50 pm
Raevmo:
No. He just cried when he got caught. BTW, I'm not Catholic and clearly not a holocaust denier but am more concerned with corruption occuring now than a church revocation of excommunication.
Comment by Bradford — February 2, 2009 @ 3:50 pm
February 2nd, 2009 at 8:12 pm
Pixie wrote:
Why do I have to repeat over and over again that the intelligence need not be God spelled with a big “G” or god with a small “g”. Of course, God or god is a possibility but it’s not the only one.
My problem with that is I don’t see, with what we know at the present , how that is even possible. First of all, the coded sequences that make up DNA strands are more than just sequences. They are for all intents and purposes programs that help construct and control the biochemical machines that run all the cell functions the are required for self replicating life. If there an unknown chemical law that directs the how DNA’s nucleotides assemble themselves then it certainly is very different from the way we observe other natural laws, made familiar to us by the sciences of physics, chemistry and biology, operating.
Stephen C. Meyer points out this problem with this in an article that he wrote for “First Things.” He writes:
http://www.discovery.org/a/200
Going back to my version of the “tornado in the junkyard” (Actually in my version the tornado creates a junkyard of sorts) the sequence of letters from the scrabble set, that formed the message “IN THE BEGINNING WAS THE WORD” obviously couldn’t have been created by the tornado. We both agree on that point. However, imagine that the letters had little magnets on them so that they had a tendency to attach themselves to each other in right side up in the right orientation an in neat little rows. Would that explain the message? This is the point that Meyers is trying to make in the quote above. Know one understands a way to create a specified coded sequence by any known natural law.
Like I said earlier, I don’t see, with what we know at the present, how that is even possible. Notice that I didn’t say it was impossible. As I said earlier in the thread it is always possible that there is some explanation “x” that is completely beyond our understanding.
The problem I have with that, however, is when I try to imagine what that could be I begin to think that it must be something that acts like intelligence. But if it is something unknown that acts like intelligence why not consider what we do know– intelligence.
Comment by JOHN_A_DESIGNER — February 2, 2009 @ 8:12 pm
February 2nd, 2009 at 8:40 pm
JAD:
Because we have no evidence of intelligent beings around when life got started. And because we know from mathematics that simple dynamical systems can give rise to complex systems. And because we have evidence that self-replicating molecules exist. Together, these facts indicate that a non-intelligent origin of life is a very reasonable hypothesis. Most importantly, this hypothesis is being expanded and tested as we speak, unlike your hypothesis that God did it which appears to be a dead end. Is that really so hard to understand?
Comment by Raevmo — February 2, 2009 @ 8:40 pm
February 2nd, 2009 at 9:01 pm
Yes, especially when 'those facts' do nothing to speak against an intelligent origin of life. And the 'expanding and testing' happens to come in the form of intelligent agents attempting to produce life from non-life. If somehow they were able to succeed, fantastic – they'll have demonstrated what intelligence is capable of.
Comment by nullasalus — February 2, 2009 @ 9:01 pm
February 2nd, 2009 at 9:36 pm
Nullasalus to Raevmo
Paul Davies makes that very same point in his book, The 5th Miracle.
"[W]ithout a trained organic chemist on hand to supervise, nature would be struggling to make RNA from a dilute soup under any plausible prebiotic conditions. So, although an RNA world could conceivably function and evolve towards life if handed to us on a plate…getting the RNA world going from a crude chemical mixture is another matter entirely.” (The 5th Miracle, p131)
Davies, BTW, is not an ID’ist. He is however able to look objectively at a problem.
Comment by JOHN_A_DESIGNER — February 2, 2009 @ 9:36 pm
February 3rd, 2009 at 5:53 am
JAD
So you demand a "detailed description" from my prefered theory, but with regards to your own, you refuse even to settle on who the designer might be, let alone how he accomplished anything. Can you not see the double standards here?
I imagine you will object that knowing the identity of the design is not required. If so, then you need to explain why my theory is expected to include a "detailed description" of the mechanisms, whilst you theory can be essentially content-free.
Okay, opinion noted. A lot of people disagree. We will have to wait and see how the research pans out, and whether abiogenesis research gets an answer before ID research. I know where I will put my money – given that the former is happening right now, and the latter looks unlikely to ever happen.
You seem to have dragged the discussion into origins of life; I guess that is one of the few remains "gaps" that IDists feel safe in. I was hoping you might be able to address some of the other issues we had been discussing. Are you willing to concede that theists have an apriori commitment to the position that the universe was created? Would you accept that that commitment is probably stronger than the naturalist commitment to his world view? Will you concede that Blackmore does accept the existence of consciousness (it is not an important point, but would reassure me that you are capable of admitting you are wrong; something I doubt about certain people round here)? I still do not know what you mean by saying life has purpose and meaning and that this purpose and meaning transcends what you observe in nature, given that you think this claim is not controversal. Let's leave OOL to a thread on OOL.
Comment by The Pixie Again — February 3, 2009 @ 5:53 am
February 3rd, 2009 at 9:50 pm
Pixie wrote:
Dragged? Like kicking and screaming dragged? Okay, but there is a method to my madness. In chapter 8 of his book, The Conscious Mind, David Chalmers shares some speculations that he has about the connection between information and consciousness. What does he mean by information? The coded sequences I have been talking about in connection with the origin of life is exactly what Chalmers means by information. But we can get back to that, if you wish.
Well let’s see, I quoted Blackmore as saying:
“I long ago concluded that there is no substantial or persistent self to be found in experience, let alone the brain. I have become quite uncertain as to whether there really is anything it is like to be me.”
You replied with a quote from her article, “There is No Stream of Consciousness“:
“As far as I can see, her claim is that our perception of consciousness is not how cobnsciousness reeally is, thus our perception of it is an illusion. I think she still believes we do have a consciousness: "When I say that consciousness is an illusion I do not mean that consciousness does not exist. I mean that consciousness is not what it appears to be."
I then quoted Blackmore from the same article, where she concludes:
“I asked at the outset 'What is all this? What is all this stuff – all this experience that I seem to be having, all the time?'. I have now arrived at the answer that all this stuff is a grand illusion. This has not solved the problems of consciousness, but at least it tells us that there is no point trying to explain the difference between things that are in consciousness and those that are not because there is no such difference. And it is a waste of time trying to explain the contents of the stream of consciousness because the stream of consciousness does not exist.”
I then commented that I found her thinking to be confusing and inconsistent. At least that’s what I was trying to say with my game show illustration. You know, “Will the real Susan Blackmore, please stand up.”
You replied:
She rejects the "stream of consciousness" – which is what the article is about – but not consciousness itself.
When or where did I say that she rejected consciousness? Provide the quote please and I’ll admit that I misspoke. But if she denies the reality of a conscious self, as well as the so called stream of consciousness, what exactly is she conscious of? I will concede that she is talking about something that she calls consciousness. But what the hell is it?
Then you are not understanding my argument. My argument very simply is that an intelligence, any kind of intelligence can explain a coded sequence, whether the coded sequence is made up scrabble pieces, colored marbles, or DNA nucleotides. At present, there is no known natural process that can create a coded sequence from scratch. (As would be needed to explain the origin of life)
I’ll make that a separate post. So as they use to say in the good old days, “Stay tuned.”
Comment by JOHN_A_DESIGNER — February 3, 2009 @ 9:50 pm
February 4th, 2009 at 5:45 am
JAD
If you want to talk about information, then go ahead, if you think it relevant. It is when you get down to demanding that I explain how life started that I am wondering about the relevance ("If that is true, then at the very least you should be able to give me a detailed description of how the initial DNA or RNA strands were encoded using only the natural processes that existed in the environment of the early earth.").
With regards to Blackmore, you originally said: "There are some strict naturalists like Susan Blackmore who actually think that the idea of a personal self, including for themselves personally, is an illusionary one." I am, rightly or wrongly, equating personal self with consciousness. Here is what she says: "When I say that consciousness is an illusion I do not mean that consciousness does not exist. I mean that consciousness is not what it appears to be."
Here is an analogy, to illustrate how I understand that. I might say that my perception of my computer is an illsusion. It appears to be and feels like a solid object. But that is just an illusion. The reality is that it is made up of countless atoms, and each atom is mostly empty space, and is in any case merely a wavefunction. Thus the computer is an illusion, in the sense that, yes, it does exist, but it is not what it appears to be.
You quoted Blackmore: “I long ago concluded that there is no substantial or persistent self to be found in experience, let alone the brain. I have become quite uncertain as to whether there really is anything it is like to be me.” Her argument is not that the self does not exist, but that the persistent self does not exist. That is, that consciousness is a series of discrete events, that there is no stream of consciousness. Rather, you are fooled into thinking that these discrete events flow seemlessly from one to the next. The stream of consciiousness, the persistence of self is an illusion, the discrete events are the reality.
You also quoted Blackmore saying (I am just repeating the end of it): "… And it is a waste of time trying to explain the contents of the stream of consciousness because the stream of consciousness does not exist.” Again, she is arguing that the stream of consciousness is an illusion. We perceive our conscousness to be continuous, but the reality isd otherwise. That is different to saying consciousness itself is illusionary, and does not exist.
Blackmore states she believes in consciousness, and I believe that that includes the idea of a personal self. You claimed she rejected the idea of a personal self.
I found her writing to be perfectly consistent, but it does take some thinking to get your head around it. She did not convince she was right, but I saw no reason to suppose she is wrong.
So here is an analogy for you. Suppose a forensic scientist came to the conclusion that the victim had been killed by an intelligent agent; is that good enough? Of course not. The forensic scientist is supposed to establish how the intelligent agent perpetrated the crime, he is supposed to find evidence that points not merely to an intelligent agent, not simply to a member of the human race, but hopefully to a specific individual. Declaring "design" and then refusing to go any further just does not cut it.
So why do you demand a "detailed explanation" fro the naturalists, but refuse to consider it even a problem for design?
Do you consider yourself to be an intelligence? Do you think you could code a message into DNA? Personally, I would answer those questions "yes" and "no". It would be impossible for mankind to encode DNA/RNA at the origins of life; we just were not there, so did not have the opportunity. I think your claim that any kind of intelligence could produce a coded sequence in DNA is very readily disproved. There are different kinds of intelligence with different resources at their disposal, different abilities, different opportunities. Sadly, ID is unwilling to acknowledge that – and I think we all know why.
Comment by The Pixie Again — February 4, 2009 @ 5:45 am
February 5th, 2009 at 12:12 am
Just for review here is what I originally wrote that got this whole discussion started.
Goetz and Taliaferro quote Michael Ruse and E.O. Wilson as an example of the way naturalists think about morals, values and meaning. In a joint article entitled “Moral Philosophy as Applied Science” they write:
“Human beings function better if they are deceived by their genes into thinking that there is a disinterested objective morality binding upon them, which all should obey. We help others because it is “right” to help them and because we know that they are inwardly compelled to reciprocate in equal measure. What Darwinian evolutionary theory shows that this sense of “right” and the corresponding sense of “wrong,” feelings we take to be above individual desire and in some fashion outside biology, are in fact brought about by ultimate biological processes.”
Is this true? Are we simply being deceived by our genes? So not only with our morals but our sense of purpose and meaning are just illusions? Is this a true description of the way human beings really are? How do Ruse and Wilson know this?
One of my favorite movies is the 1942 film Casablanca starring Humphrey Bogart and Ingrid Bergman. Here’s a short synopsis:
At the beginning of the movie we meet Rick Blaine (Bogart) an expatriate American who owns a nightclub (Rick's Café Américain) in the Morrocan city. We also learn that Rick is bitter and cynical for some reason. We soon learn why when a Ilsa (Bergman) Rick’s former lover walks into his club with her husband. Rick and Ilsa had met and fallen in love while both of them were living in Paris, sometime before the Nazi’s invaded the city. Now Rick learns that Ilsa had been married at the time to Victor Laszlo a Czech Resistance leader. Ilsa tries to explain to Rick that she thought that her husband had been killed only to learn just before the fall of Paris that he had escaped from a Nazi concentration camp. Still embittered Rick refuses to even listen to her. But Rick has something that Ilsa and her husband need: letters of transit that will get them through Nazi territory to freedom. Ilsa loves both men though for different reasons, so she makes a choice. She convinces Rick to help her husband escape promising to stay with him. However, at the plane Rick has a change of mind (though not a change of heart.) He insists that Ilsa leave with her husband. Ilsa however is confused. So he explains:
Rick: If that plane leaves the ground and you're not with him, you'll regret it. Maybe not today, maybe not tomorrow, but soon and for the rest of your life.
Ilsa: But what about us?
Rick: We'll always have Paris. We didn't have it before…we'd…we'd lost it until you came to Casablanca. We got it back last night.
Ilsa: When I said I would never leave you…
Rick: And you never will. But I've got a job to do, too. Where I'm going, you can't follow. What I've got to do, you can't be any part of. Ilsa, I'm no good at being noble, but it doesn't take much to see that the problems of three little people don't amount to a hill of beans in this crazy world. Someday you'll understand that. Here's looking at you, kid.
Now, does Rick do the right thing? The noble thing? Or, the stupid thing? Is this a story that is void of purpose and meaning? Is this something that can explained as a result of our “deceptive genes?”
Oh, I know, Casablanca, is fictional. But it is a story the really resonates with most people. Why? Also this is a movie that was released in the midst WW II. There was nothing fictional about men leaving their wives and sweethearts and children with the possibility that they might never see their loved ones again.
That is what I mean by a “purpose and meaning and that this purpose and meaning transcends what I observe out there in nature.” I don’t observe anything like that out there in nature.
Comment by JOHN_A_DESIGNER — February 5, 2009 @ 12:12 am
February 5th, 2009 at 9:36 am
When you said "transcend", I took that to mean, going beyond the natural world. Something beyond the nural world is supernatural, and I was assuming you meant more specifically God's purpose and meaning. I agree that peoples lives have purpose and meaning, though to me that purpose and meaning comes from people. I see no need to look outside of nature for that, but then I see poeple as being part of the natural world.
Comment by The Pixie Again — February 5, 2009 @ 9:36 am
February 6th, 2009 at 12:33 am
Pixie wrote:
In a blurb on the back cover of Susan Blackmore’s book: The Meme Machine, the publisher (Oxford University Press) describes what the book is about this way:
Indeed in Chapter 17 Blackmore makes it very clear that she believes that the self is an illusion.
According to the dictionary when you say something is an illusion you are saying that it is “an unreal, deceptive or misleading appearance or image.”
You quoted me above as saying: "There are some strict naturalists like Susan Blackmore who actually think that the idea of a personal self, including for themselves personally, is an illusionary one."
I bought her book last summer. I haven’t read it yet cover to cover but I did read, among others, chapter 17 entitled “The ultimate memeplex“. (The self is ultimate memeplex.) It seems to me that I understood exactly what she was saying and what she meant.
Comment by JOHN_A_DESIGNER — February 6, 2009 @ 12:33 am
February 6th, 2009 at 8:13 am
JAD
I agree
I read her book awhile back and her meaning could not be more clear. Toward the end of the book she even tells of her struggles in trying to live out her beliefs consistently
Comment by fifth monarchy man — February 6, 2009 @ 8:13 am
February 6th, 2009 at 9:20 am
"I" is not properly an illusion, but a sensation of how the mind works. Self-consciousness may be somewhat nebulous in its boundaries, but it certainly seems to be a real component of the human mind.
Persistent does not mean unchanging.
Comment by Zachriel — February 6, 2009 @ 9:20 am
February 6th, 2009 at 2:12 pm
Right. So that doesn't mean the conscious self doesn't exist at all, it only means that it isn't what it appears. Specifically, it appears to be some higher process which we control explicitly in all regards, but it may actually be nothing more than the sum result of many lower processes which together call into question precisely what the "we" was that we thought was in control.
The interesting question is in what ways, if any, Blackmore thinks this proposition should change our behavior. Since she wrote a whole book about it, I strongly doubt she thinks it means we should stop acting as if we're conscious selves.
Comment by don provan — February 6, 2009 @ 2:12 pm
February 6th, 2009 at 2:43 pm
I think Dawkins covers this fairly well in a couple places. Our morals and sense of purpose change continually, far faster than genetic change can explain. So the idea that genes drive morality directly seems silly. What our genes have given us is much more fundamental, like the stuff that encourages us to learn from our parents and to see other creatures, including other humans, as potential allies more than necessary antagonists.
And here Dawkins memes make more sense. We feel there are morals and purposes because those concepts spread well. We see this everyday right here at TelicThoughts: no idea falls flatter and faster than someone saying "there's no purpose." No organization of people stays together without a shared concept of trust. So it's no surprise that the idea of morals and a sense of purpose are pervasive in the surviving society.
Are they illusions? Well, no, at least not necessarily. Some memes, such as the scientific method, spread precisely because they do give us accurate input on how the world around us behaves. Dawkins himself might condem other memes, such as Christianity, for other reasons, but the fact that Christianity is a meme (well, a collection of memes, actually) doesn't, in itself, mean that Christianity isn't 100% true. (On the other hand, as Dawkins would quickly point out, it does explain how Christianity could be so popular even if it didn't have a shred of truth to it.)
But what do we really mean by "illusion"? When we get right down to it, all we mean is that "morality" may or may not be some independent, permanent, unchangable aspect of reality. But do any of us really believe that, anyway? It seems no more reasonable than Santa Claus. Like Santa Claus, it makes more sense as something to instruct and guide us, and, also like Santa Claus, it does that just as well even if it doesn't actually exist.
Comment by don provan — February 6, 2009 @ 2:43 pm
February 6th, 2009 at 5:55 pm
DP
I suggest you read the book I think you would be surprised.
At one point she talks about coming to an intersection every day and trying her best not to make a decision as to which way to go because after all there is no Susan to make such a decision. She even speaks of moments when for a split second she thinks she has finally accomplished her goal and put all the old superstition behind her once and for all.
I found it quite funny to imagine a woman on a country road in England struggling desperatly with the fact that her imaginary self is compelling her to turn right.
I can see her talking to her imaginary self about all the latest scientific studies that prove once and for all that she does not exist but not being able to take that final leap of faith.
Finally after minutes of struggle in tears she heads for home only to try again tomorrow.
now that's comedy
Peace
Comment by fifth monarchy man — February 6, 2009 @ 5:55 pm
February 6th, 2009 at 10:40 pm
fifth monarchy man:
How ironic Don hasn’t read Blackmore’s book but nevertheless, he is somehow able to divine what she really meant; even though what she really meant is not what she really said. But, I guess that is because Don just somehow knows this stuff and you and I are just a couple of “IDiot’s”.
Comment by JOHN_A_DESIGNER — February 6, 2009 @ 10:40 pm
February 7th, 2009 at 3:27 am
To quote Alister Mcgrath "has anyone actually seen these things, whether leaping from brain to brain, or just hanging out?"
Don have you seen them?
Vivid
Comment by Vividbleau — February 7, 2009 @ 3:27 am
February 8th, 2009 at 5:51 am
Huh? Of course. We all have. The Lord's Prayer is a meme. Belief in astrology is a meme. The scientific method is a meme. We see them all the time, we see them pass from brain to brain in everything from college courses to marketing jingles.
Comment by don provan — February 8, 2009 @ 5:51 am
February 8th, 2009 at 9:54 am
What color are they? How much do they weigh? They sound an awful lot like a supernatural explanation to me.
peace
Comment by fifth monarchy man — February 8, 2009 @ 9:54 am
February 8th, 2009 at 10:19 am
A typical meme might be a melody that everybody likes to hum, or a catch-phrase that everyone likes to repeat. That's hardly supernatural. In the meme paradigm, any element of culture can be treated as a meme.
Comment by Zachriel — February 8, 2009 @ 10:19 am
February 8th, 2009 at 10:23 am
Zach:
I'm sorry that’s exactly what I mean when I say supernatural i.e. not reducible to matter and natural law .
If it can’t be weighed or measured it is supernatural (above nature) by definition.
How is a meme different from a human soul?
peace
Comment by fifth monarchy man — February 8, 2009 @ 10:23 am
February 8th, 2009 at 10:43 am
An abstraction is an association. That doesn't make it supernatural.
I'm not sure where you get that idea from. Don Provan mentioned marketing jingles. Advertisers measure how well these jingles propagate through their target audience, and the correlation with sales.
Comment by Zachriel — February 8, 2009 @ 10:43 am
February 8th, 2009 at 10:51 am
Zach:
english please
Avertisers are not measuring the meme itself but it’s effects
In the same way you can measure how a soul interacts with other souls by watching a conversation and observing its effects . This does not equate to measuring a soul.
peace
Comment by fifth monarchy man — February 8, 2009 @ 10:51 am
February 8th, 2009 at 11:15 am
Numbers are abstractions. Computers can add numbers. Computers are not supernatural.
In science, you need to use terms with reasonable, operational definitions. A meme is an element of culture. A typical meme might be a melody that everybody likes to hum, or a catch-phrase that everyone likes to repeat. Advertisers measure who quickly and pervasively a jingle propagates through the culture. That's hardly supernatural.
Comment by Zachriel — February 8, 2009 @ 11:15 am
February 8th, 2009 at 12:30 pm
Zach
This could be a very interesting discussion the problem is given your history I have absolutely no way of knowing if you are pretending or not. I’ll respond once more and unless you give me evidence you are serious I’ll leave you to play with yourself
That’s your opinion I believe numbers have existence apart from nature and are therefore supernatural. How can we scientifically decide who is right?
Human bodies can contain souls. Bodies are not supernatural your point is?
are you saying that if somthing can be defined it's not supernatural?
I can define "Soul" and "God" etc.
A typical soul might be Zach or FFM blah blah blah…………….
If it can’t be measured or weighed it is supernatural by definition
peace
Comment by fifth monarchy man — February 8, 2009 @ 12:30 pm
February 8th, 2009 at 12:41 pm
Zach,
Interesting example. The effect of memes can be measured empirically.
The real test, however, is whether we can predict the propogation of a meme by it's inherent measurable properties. Do you think we could adequately quantify the characteristics of a musical expression in order to make a specific, distinguishing, and falsifiable prediction about it's propogation?
The answer should give us an idea of the usefulness of these kinds of memes in science.
Comment by chunkdz — February 8, 2009 @ 12:41 pm
February 8th, 2009 at 2:28 pm
It's not a matter of "science". It's a matter of agreeing to a reasonably clear definition of the term "supernatural", and then applying it consistently and consistent with normal discourse.
According to that statement computers manipulate the supernatural. To avoid such confusion, we can consider abstractions to be associations or defined relationships.
A jingle has no weight, but is certainly a natural object.
Advertising executives would love to know. Humans are notoriously hard to predict, so the ability to foresee the trajectory of a meme is very limited.
Not very.
Comment by Zachriel — February 8, 2009 @ 2:28 pm
February 8th, 2009 at 3:17 pm
Zach,
No, a jingle is an abstraction. It is not observable any more than numbers are.
Comment by chunkdz — February 8, 2009 @ 3:17 pm
February 8th, 2009 at 5:10 pm
Unless you are using words in a special chunkdz-manner, of course we can observe a jingle. We hear it, as in "I heard a jingle on the radio". If you want, you can even use a device that converts musical tones to visual or digital representations.
Comment by Zachriel — February 8, 2009 @ 5:10 pm
February 8th, 2009 at 8:21 pm
Zachriel,
Mozart composed symphonies entirely in his head. He later represented them on paper with ink, then by vibrating air molecules, then later the symphony could be represented by magnetic domains of ferric oxide, or by a pulse code modulated Reed Solomon encoding algorithm.
Of course, if it was never written down it would still be a symphony.
In fact, I have an original tune in my mind at this very moment. Do you think it doesn't exist yet?
Comment by chunkdz — February 8, 2009 @ 8:21 pm
February 8th, 2009 at 8:37 pm
This is classic.
You are making a claim that memes are responsible for the Lords Prayer etc. That is your hypothesis. I want to see the memes itself not what you claim are the memes effects.
So I ask again Don "has anyone actually seen these things, whether leaping from brain to brain, or just hanging out?"
Vivid
Comment by Vividbleau — February 8, 2009 @ 8:37 pm
February 8th, 2009 at 10:14 pm
Sym-phony means a harmony of sounds (sounds together).
I don't think it is disputed that the mind can be a repository of abstract ideas. However, it only becomes a meme, defined as an element of culture, when it is in a transmissible form.
Comment by Zachriel — February 8, 2009 @ 10:14 pm
February 8th, 2009 at 11:00 pm
Sounds very much like a meme is an idea.
Dawkins goes much further he likens a meme to a gene. A gene is a self replicating unit and a meme like a gene is itself a self replicating unit. Now I can see a gene under a microscope where can I see this self replicating unit Dawkins callls a meme?
Vivid
Comment by Vividbleau — February 8, 2009 @ 11:00 pm
February 9th, 2009 at 1:36 am
I haven't had time to keep up, but I gather that the theme here is that the dualists claim ideas in our brains are not reducible to materialistic causes. Understanding of the brain is limited, but there is evidence to suggest that the thoughts in our brain are stored as a weighted graph. Electrical impulses cause a strengthening of dendrite connections between neurons in a hierarchal structure. Computer scientists use primitive versions of similar structures to store all sorts of data. Every thought in our brains can be seen to correlate to electro-chemical impulses and there is certainly enough evidence to suspect our ideas are stored in a physical media. So the movement of memes from one mind to another is very likely a physical transfer of information completely analogous to transfer between other physical storage mediums. Of course currently we lack the technology to 'see' the encoding of ideas in our brains, but experiments have been successfully performed to graft living brain cells to microchips and then use the cells to store and retrieve information.
Comment by Todd Berkebile — February 9, 2009 @ 1:36 am
February 9th, 2009 at 5:30 am
No. The Lord's Prayer is a meme, it isn't caused by memes.
"Our Father, who art in Heaven…" OK?
"Meme" is a very clearly defined concept. We can debate whether the concept is useful or not and whether Dawkins's ideas about memes are valid or not, but we can't start such conversations until you understand what a meme is to begin with.
Comment by don provan — February 9, 2009 @ 5:30 am
February 9th, 2009 at 5:58 am
A meme can be studied and observed just like any idea can be studied and observed. Is the Lord's Prayer supernatural?
You can measure how people interact. You can't mean how souls interact, at least not for any definition of "soul" I'm aware of.
Comment by don provan — February 9, 2009 @ 5:58 am
February 9th, 2009 at 7:19 am
I see the Don memeplex is spreading the conversation meme-virus – the idea that meaningful (where's the meaning meme?) conversations can be had about memes. Related to the meme that memes are concrete and real. I wonder if it has any survival advantage. Then again, does the survival advantage meme have any survival advantage?
Of course the meme that memes are abstract to the point of being rather useless is a powerful meme. It even seems to be spread throughout the scientific community, hence why the meme meme is more popular in casually describing ytmnd.com trends and lolcat pictures than in any serious field of study. Of course the meme meme is being produced by memeplexes in an attempt to institute a connection to the rational idea meme and the evolutionary psychology meme. But the evo-psych meme is heavily contaminated by linkages to the 'that field is a bunch of fantasy nonsense' meme. So much for the meme meme. And the meme meme meme isn't faring too well either. I suppose the 'memes are silly' meme has just been too successful.
…
Comment by nullasalus — February 9, 2009 @ 7:19 am
February 9th, 2009 at 8:20 am
DP
Being that supernatural simply means not reducible to matter and natural laws I would say that by definition the Lords prayer is supernatural ie above nature
It appears that you are defining supernatural as “stupid” or “unexplained” or “non existing” this is not what supernatural is.
Before we have a conversation about the supernatural perhaps it migt be good to understand what it means.
soul: from here
3: a person's total self
Before we have a conversation about the Soul perhaps it migt be good to understand what it means.
peace
Comment by fifth monarchy man — February 9, 2009 @ 8:20 am
February 9th, 2009 at 9:23 am
By that definition, so is "plop, plop, fizz, fizz" and every mundane jingle cooked up on Madison Avenue, or sitcoms, or the bugling of an elk in rut. You probably should use scare-quotes around the term supernatural, otherwise, no one will know what you're talking about. Is there some utility to such a wayward definition, or is it just a way to presuppose your beliefs?
Comment by Zachriel — February 9, 2009 @ 9:23 am
February 9th, 2009 at 9:34 am
Funny, I ask this sort of thing about memes in general.
Comment by nullasalus — February 9, 2009 @ 9:34 am
February 9th, 2009 at 12:09 pm
Since Dawkins coined the term I would have thought that he would be the one to best understand what a meme is. Now Don am I correct in stating that Dawkins meme is, like the gene, another self replicating unit?
Vivid
Comment by Vividbleau — February 9, 2009 @ 12:09 pm
February 9th, 2009 at 12:43 pm
Lol!
Comment by chunkdz — February 9, 2009 @ 12:43 pm
February 9th, 2009 at 1:09 pm
Well, obviously the Lord's Prayer can be studied, so I guess you're agreeing with Fishman's claim from the other thread that the supernatural is open to scientific investigation.
I already said you can study how people interact, so if you were using "soul" in this manner, then we agree.
Comment by don provan — February 9, 2009 @ 1:09 pm
February 9th, 2009 at 1:14 pm
Personally I'm a little unclear what you mean by "self replicating", but genes and memes are both replicated, yes.
Comment by don provan — February 9, 2009 @ 1:14 pm
February 9th, 2009 at 7:24 pm
Well if your unclear what I mean by "self replicating" then your unclear what Dawkins means because thats the term he uses!! Furthermore that means your comment to me
Is the pot calling the kettle black
So perhaps I should help you understand
This is from chapter 11 of "The Selfish Gene"
Now Dawkins talking about these memes states:
"Just as genes propagate themselves in the gene pool by leaping from body to body via sperms or eggs, so memes propagate themselves in the meme pool by leaping from brain to brain via a process which, in the broad sense, can be called imitation"
So I ask for a third time, has anyone actually seen these things, whether leaping from brain to brain, or just hanging out?
Dawkins goes on to say
"As my colleague N.K. Humphrey neatly summed up an earlier draft of this chapter: `… memes should be regarded as living structures, not just metaphorically but technically"
and
"And this isn't just a way of talking — the meme for, say, "belief in life after death" is actually realized physically, millions of times over, as a structure in the nervous systems of individual men the world over.'"
Memes are actually realized physically millions of times. Dawkins speaks of memes of having a physical component so Don have you seen one? I would be particualrly interested in the meme that causes people to believe in memes
I would also like to know where I can look for this physical structure in the nervous system he speaks of ? Are they hiding in there or what?
Vivid
Comment by Vividbleau — February 9, 2009 @ 7:24 pm
February 9th, 2009 at 7:29 pm
Zach
Yes any thing that requires a conscious mind to "cook up" would by definition be supernatural.
Unlike your other examples I think a good case can be made that a bull elk's buggle can be explained by matter and natural law alone but I would be open to the possibility that it is not reducible to such things. Go ahead make your case.
Why? Mine is the proper dictionary definition if some one is confused all they have to do is look it up. Words have meanings.
It’s not a wayward definition it’s the standard definition
1. of, pertaining to, or being above or beyond what is natural; unexplainable by natural law or phenomena; abnormal.
It’s used in this way every day by Theologians and Philosophers and has been since ancient Greece
The problem is not with my use it’s with yours. You call something supernatural when what you really mean is “not real”. This is one way you presuppose your belief system?
By defining Supernatural as stupid or unexplained you can more easily ignore it and instead of trying to understand it. You can then you ridicule those of us who rightfully claim that nature is not all there is instead of interacting with us on a level playing field .
It’s an old dodge but a dodge none the less
DP
I completely agree we study the affects of the supernatural every day that’s what anthropology and archeology and ID are all about.
It's ID critics who say other wise.
What we can’t do is study the supernatural itself by empirical means. For some reason folks on your side seem to believe that studying the affects of something is the same as studying it. This is the category error of Scientism.
Release the doves a new era has dawned!!!!!!
So when I say that the soul exists you would agree as well I assume?
Would you also agree when I say that my soul is not reducible to the matter (in my body) plus natural law but contains somthing beyond nature?
Peace
Comment by fifth monarchy man — February 9, 2009 @ 7:29 pm
February 9th, 2009 at 7:41 pm
We have seen biological neurons storing information, yes. I can't find the link, but I remember one study where they grew rat brain cells and grafted them to a computer chip. They could read and write information into the neurons. We do not yet know all the details of how that storage works, if that's what you're trying to get at.
Do some research into dendrites and axons in nerve cells then. I recommend On Intelligence by Jeff Hawkins, it presents one particular theory in a format easy for laymen to understand.
Comment by Todd Berkebile — February 9, 2009 @ 7:41 pm
February 9th, 2009 at 7:48 pm
The soul is easily defined into existance, most things are. If you define 'soul' as 'all of a being' then I have to agree that other people do exist. I guess its good that I'm gaining weight, apparently it expands my soul.
No, this doesn't follow from the definition you gave.
Comment by Todd Berkebile — February 9, 2009 @ 7:48 pm
February 9th, 2009 at 7:54 pm
Vivid: Dawkins goes on to say
Vivid:
Todd, your answer needs to respond to the issue raised. Unless specific biological activity involving dendrites, axons and nerve cells corresponds to an identifiable structure, correlating to Dawkins' belief in life after death example, then your response falls short of the mark.
Comment by Bradford — February 9, 2009 @ 7:54 pm
February 9th, 2009 at 7:57 pm
That is your presupposition—not in the definition.
Comment by Zachriel — February 9, 2009 @ 7:57 pm
February 9th, 2009 at 8:03 pm
So just to be clear you do believe you are reducible to only natural law and matter.
It is implied by the definition if we assume that a conscious mind is not reducible to only natural law and matter.
are you reducible to only matter and natural law?
peace
Comment by fifth monarchy man — February 9, 2009 @ 8:03 pm
February 9th, 2009 at 8:15 pm
A meme is raw information, the dendrites and axons form a data structure that holds information through physical structure. There are multiple ways to encode the same information so there would not be exactly one weighted graph of connected neurons for the 'meme' meme, plus information transfer from one brain to another is lossy so the pattern would vary, but in theory the only thing preventing us from reading the meme out of someone's brain is scanning technology. The information, or thought, or meme, or whatever you want to call it is physically encoded in the brain.
Your question is analogous to being given all the machine code for Windows and then being asked to find the 'data compression' meme. Well, code to perform data compression comes in many forms (zip files, jpeg encoders, etc) and lives in many places (gdiplus.dll, iexplore.exe, cryto32.dll, etc) making the search rather impractical, but the search is not impossible. By knowing how code works and how computers work we can know that the search is possible even without actually performing the search.
Comment by Todd Berkebile — February 9, 2009 @ 8:15 pm
February 9th, 2009 at 8:21 pm
I have no reason to believe I cannot be reduced to a naturalistic explanation. Given a lack of conflicting evidence I tentatively accept that nothing more is required.
You do realize that when you have assume A in order to believe B then it means your belief in B is by definition a presupposition based on that assumption, right? So I'm assuming you were trying to agree with Zach but didn't want to appear terse by simply saying, 'yes.'
Comment by Todd Berkebile — February 9, 2009 @ 8:21 pm
February 9th, 2009 at 8:25 pm
So futuristic brain scanning technology should tell us what brain dynamics correspond to the thoughts I'm presently expressing? That's an interesting claim with some obvious falsification indicators.
Comment by Bradford — February 9, 2009 @ 8:25 pm
February 9th, 2009 at 8:48 pm
So in your view there is no fundamental difference between yourself and a pile of wood chips.
Most folks happen to disagree. We think we have plenty of evidence of the fact that we are more than just so much stuff.
We think you are being dishonest to deny that evidence because of it‘s implications.
I hope we can agree this is probaly the most important question in the universe.
How can we tell scientifically who is right?
By the way
Is information itself reducable to only matter and law?
peace
Comment by fifth monarchy man — February 9, 2009 @ 8:48 pm
February 9th, 2009 at 8:48 pm
Yes, it is a claim that is subject to verification or falsification and current research is specifically trying to do just that. Experiments grafting cells to circuits have the potential to provide a wealth of information regarding how neurons store information; especially when/if IBM's new molecular scale MRI equipment enters the mainstream. We live in exciting times.
Comment by Todd Berkebile — February 9, 2009 @ 8:48 pm
February 9th, 2009 at 8:58 pm
What makes you reach that conclusion? I certainly didn't say that, nor do I believe that. I have a special arrangement of matter and energy which gives me significantly more ability than a pile of wood chips. What we are and how we behave will not in any way change based on which one of us is correct.
Well, I'll try not to be offended if you try to accept that I am being honest and sincere. I have no idea what evidence it is you think I'm denying and I would love for beautiful fairy tales like eternal life to be true but it just doesn't seem likely.
I can see why you might think so, as your life is likely based largely on this conviction. For me, my life would change very little based on whether I am right or wrong about this.
I don't think we can. NOMA and all that. I think science can continue to make it seem less and less likely that the supernatural is necessary but it isn't the job of science to disprove the supernatural, only to prove the natural.
I am not aware of any form of information that isn't.
Comment by Todd Berkebile — February 9, 2009 @ 8:58 pm
February 9th, 2009 at 8:59 pm
Actually I answered too quickly I was trying to emphasize that supernatural begets supernatural when I should have just said
…..If information is more than matter plus law then those things are supernatural by definition.
Now I realize that is also an assumption, but definitions are information so to disagree would also be a presupposition.
The fact is either of can’t get past that particular presupposition it’s at the core of our being.
peace
Comment by fifth monarchy man — February 9, 2009 @ 8:59 pm
February 9th, 2009 at 9:01 pm
You've already demonstrated a weak understanding of memes, so I have no idea whether you are using it the way Dawkins meant it.
I've explained to you that you are observing a meme every time you hear the Lord's Prayer. "Leaping" is, of course, just analogical. You know how you learned the Lord's Prayer, and that's how it got to your brain. As I suspected, you think "self-replicating" means that the meme itself has its own mechanism for replicating, so you don't recognize that teaching is an example of how memes "leap" from one brain to another.
It's fine to be a dualist and imagine higher order reality to our minds, but it remains an established fact that there's a physical manifestation of memories in our brains that you have to recognize even as you try to trip Dawkins up as he describes the world without bothering to worry about your metaphysical ideas about the mind. The fact that we cannot look at the physical manifestation is entirely uninteresting to an understanding of memes since it is possible to study who believes what regardless of what actual physical reality those beliefs have. Do you know the Lord's Prayer? Then you have a meme.
While there's no question that Dawkins is a dedicated physicalist, memes have nothing to do with it. Memes continue to be a clear and easily established concept even if all our mental activities turn out to be entirely beyond natural processes.
Comment by don provan — February 9, 2009 @ 9:01 pm
February 9th, 2009 at 9:06 pm
“More ability” is not a fundamental difference as witnessed by the word “more”.
What is the fundamental difference?
Comment by fifth monarchy man — February 9, 2009 @ 9:06 pm
February 9th, 2009 at 9:15 pm
Yes, I agree that a person's total self exists.
No, I see no reason to agree to that. I have no reason to conclude that your total self includes anything not reducible to matter plus natural laws, although I'll also agree we don't know whether it can be reduced to matter plus natural laws, either.
So that means it isn't implied by the definition, it's implied by the additional assumption which was unstated until now.
So now that we've ruled out "supernatural" as a distinguishing feature, how do we distinguish between anthropology and archeology, on the one hand, and ID on the other? Anthropology and archeology study physical things and relate them to humans and their known characteristics. When an archeologist suggests that a known group built a wall, that gives us something to compare later results to. ID doesn't do anything like that. What do we call that difference?
Comment by don provan — February 9, 2009 @ 9:15 pm
February 9th, 2009 at 9:32 pm
Nothing that I can see
Not when dealing with Homo erectus artifacts for example.
That is step two the first step is recognizing that a feature is a designed wall and not a cliff face.
The problem is that when you rule ID out you can never get to stage two
To declare something designed is to say something about the designer ie that he designs and his designs are recognizable by us.
I can think of several ID speculations that imply even more information about the designer. Expect more as ID continues to grow.
A straw man
peace
Comment by fifth monarchy man — February 9, 2009 @ 9:32 pm
February 9th, 2009 at 10:15 pm
If your point is that some people do things in the name of anthropology that are as bad as what IDists do in the name of science, then I'll take your word for it.
I'm not convinced that you can do the first step without the second step, but even if we say you can, that still makes the first step very tiny. Archeology goes on and on, way, way beyond that point.
Who ruled out ID? I've essentially stipulated that ID is the answer, and now I'm asking you what that tells us.
Nonsense. You asserted that you could recognize his designs in order to establish that they were designs to begin with. It makes no sense to turn around now and claim that you learned that in the process when it's what you were assuming from the beginning.
At this point, I often point out that you've learned nothing that tells you that "the designer" is not, in fact, evolution itself.
For the first 10 years or so, I suppose we could let ID get away with this kind of "someday we'll really have something" argument, just to be sure ID wasn't actually saying something dramatically correct that everyone else was missing. But still nothing beyond "I can think of…"
But that's OK, no harm. Go ahead and give us your speculations and you'll move ID into the 20th century.
Comment by don provan — February 9, 2009 @ 10:15 pm
February 9th, 2009 at 10:25 pm
I have already quoted what Dawkins meant. Actually it is you that is demonstrating a weak understanding.
Dawkins memes are actually realized physically in the structure of the nervous system. Memes have a physical structure in the nervous system. Like genes they are passed on to future generations as are memes. Not because they are passed on verbally, something like oral tradition, rather, like the gene which has a physical structure in the nervous system and is passed on to future generations through differential survival value.
If the claim is that memes are nothing more than another word for "oral tradition" or 'ideas" or 'prayers" or "beliefs" that are passed on from one generation to another then why call them memes? Why not just call them what they are ie "The Lords Prayer", "Belief in God" etc. Dawkins coined the word for a specific purpose, he proposed that "belief in God" is like a gene and called "belief in God" a meme as a play on words.
The meme "belief in God" has a physical structure in the nervous system. Memes have a physical structure like genes. I suggest you read Chapter 11 of "The Selfish Gene" in order to get a better understanding of memes rather than claim I am the one that does not understand what Dawkins meant.
Vivid
Comment by Vividbleau — February 9, 2009 @ 10:25 pm
February 9th, 2009 at 10:38 pm
I would prefer that you show me the "meme" for the Lords Prayer rather than question my motives.
Vivid
Comment by Vividbleau — February 9, 2009 @ 10:38 pm
February 9th, 2009 at 10:57 pm
The edit function is no longer available.
Not because they are passed on verbally, something like oral tradition, rather, like the gene which has a physical structure a meme has a physical structure in the nervous system and is passed on to future generations through differential survival value.
Vivid
Comment by Vividbleau — February 9, 2009 @ 10:57 pm
February 9th, 2009 at 11:01 pm
DP
What? I said no such thing. I said that if you recognize that something is designed you are saying something about the designer. pay attention
.
ID does not assume anything of the sort. It only says that the best explanation for X is that it is designed. It’s that fact that reveals information about the designer not visa versa
If I hear a song coming from my neighbors house it means that my neighbor can sing. I don’t have to assume a musical ability in my neighbor to recognize this.
Is evolution reducible to matter and natural law? If so it’s not supernatural and is therefore not a designer by definition as I’ve already explained.
Privileged planet
The designer cares about intelligent life and wants his creations to observe and discover
Frontloading
The designer has a predetermined goal in mind
IC and the edge of evolution
The designer uses a verity of means to accomplish his ends and is not limited to just one mechanism.
Natures Destiny
The designer institutes tight constraints to insure his desired outcomes
How’s that
peace
Comment by fifth monarchy man — February 9, 2009 @ 11:01 pm
February 10th, 2009 at 8:44 am
In other words, you said it was in the definition, but it's not.
If the creation of a supernatural mind is supernatural, then as God created the world, then we have the perverse result that nature itself is supernatural. That is not how the term is used to draw distinctions. If someone breaks a pencil, it is not a supernatural act or event. Even though Michelangelo was inspired (filled with the breath of the Spirit), his creations are natural. They were formed by natural processes, the energy equations are in balance. Yet, he can communicate his experience of the Spirit to receptive audiences.
Comment by Zachriel — February 10, 2009 @ 8:44 am
February 10th, 2009 at 12:24 pm
The term "meme" is convenient because it is a category that includes ortal tradition, ideas, prayers, beliefs, and many other things. They are not merely passed from one generation to another but also from one person to another within a generation.
Dawkins thinks that the mind is physically in the nervous system, hence where he thinks memes are. But the concept doesn't depend on it.
Anyway, if you're going to pretend meme doesn't mean anything because you don't agree with Dawkins's metaphysics, I'm not really that interested. As long as you continue to say memes aren't real because you can't observe them even as you listen to the Lord's Prayer, you're just in denial.
How many times do I have to tell you? The Lord's Prayer is a meme. Dawkins isn't a dualist, so he would say any belief or emotion has a physical manifestation. Does the fact that Dawkins believes emotions are physical manifestations mean that psychiatry cannot be studied scientifically?
Comment by don provan — February 10, 2009 @ 12:24 pm
February 10th, 2009 at 12:53 pm
A theory of memetics doesn't require a mechanism for consciousness any more than a theory of Mendelian genetics requires an understanding of molecular biology. We observe that memes (cultural elements) are passed from individual to individual, from group to group, and we can study that process independently.
Comment by Zachriel — February 10, 2009 @ 12:53 pm
February 10th, 2009 at 2:48 pm
Zachriel,
Except that Mendel could make predictions about traits. Memetics makes no empirically testable predictions about memes.
No wonder the Journal of Memetics tanked. They couldn't even predict that their own meme would fail to propogate.
What did Popper call this non-predictive silliness? Oh yeah – pseudoscience.
Comment by chunkdz — February 10, 2009 @ 2:48 pm
February 10th, 2009 at 2:57 pm
chunkdz,
Wikipedia mentions how that was just a temporary setback, and they plan on relaunching soon.
For a chuckle, click on the journal link given under external links for the memetics page.
For a laugh, click on the actual link you get when you go to that journal link.
Comment by nullasalus — February 10, 2009 @ 2:57 pm
February 10th, 2009 at 3:17 pm
The problem with memetics is that few cultural elements can be considered fundamental. Memetics does seem to apply to some particulars, such as fads, where the spread of memes can form divergence patterns similar to those found in epidemiology. But memetics is more analogy than science, and is far from a unifying theory of how cultures evolve.
That is certainly one reasonable measure of scientific influence.
Comment by Zachriel — February 10, 2009 @ 3:17 pm
February 10th, 2009 at 3:42 pm
Zach,
Actually, the problem with memetics is that NO cultural elements are fundamental. They all begin as thoughts. Unmeasurable, unseeable, unpredictable, and untestable. It's tough to establish a science that is fundamentally based on supernatural phenomenon.
Science makes predictions about the propogations of disease. Memetics, being pseudoscience, can do no such thing. It predicts nothing.
Memetics is more stupidity than science, and is stupid.
Comment by chunkdz — February 10, 2009 @ 3:42 pm
February 10th, 2009 at 3:48 pm
We can certainly observe how a jingle propagates through a population, or how a bit of news might evolve as it is passed about in conversation. There is nothing supernatural about these observations, and no theory of mind is required to make valid generalizations about these observations.
Comment by Zachriel — February 10, 2009 @ 3:48 pm
February 10th, 2009 at 4:07 pm
Zach,
Even a jingle has it's humble origins in a supernatural event.
And until you can offer a falsifiable prediction about what will happen to that jingle once it is expressed you are merely advocating pseudoscience.
Do you have anything better to do than to come around here peddling pseudoscience?
Comment by chunkdz — February 10, 2009 @ 4:07 pm
February 10th, 2009 at 5:10 pm
We don't have to know the origin of a jingle to observe how it propagates in a population.
As I mentioned several times, memetics is of limited scientific utility. However, your particular objections are without a valid basis. If we accepted your reasoning, we could never hope to understand traffic patterns because they entail unpredictable, supernatural minds steering this way and that.
Comment by Zachriel — February 10, 2009 @ 5:10 pm
February 10th, 2009 at 5:15 pm
What makes you say you can't make a prediction about what will happen to a jingle? Marketing people make and test such predictions all the time, they just don't need the term "meme".
There's really nothing remotely controversial here. The use of fire and farming are memes studied in early humans. The only issue here — and I readily admit I know nothing about it — is whether a significant number of scientists find the concept useful. There's simply no question that it identifies things which are subject to scientific study, no matter what you think contradicts that in your mind.
Comment by don provan — February 10, 2009 @ 5:15 pm
February 10th, 2009 at 5:26 pm
Zach,
I said it's pseudoscience. You were the one who complained about the lack of fundamentals in memetics.
And as I mentioned several times it's stupid and vacuous.
Please don't make up arguments and attribute them to me.
Memetics is not stupid because it is fundamentally supernatural. Memetics is stupid because it pretends to be science even though it has never made a testable prediction. Go sell your snake oil somewhere else.
Comment by chunkdz — February 10, 2009 @ 5:26 pm
February 10th, 2009 at 5:30 pm
Not very good. In fact, I don't see any way at all to investigate those ideas to determine whether they're true or not. Maybe you should start with something easy: is there just one designer or multiple designers? After all, if you manage to identify characteristics, it will be important to know whether there are different designers with different characteristics, won't it?
Comment by don provan — February 10, 2009 @ 5:30 pm
February 10th, 2009 at 5:33 pm
chunk:
I wonder why the meme that memetics is stupid is so successful among our religious friends.
Comment by Raevmo — February 10, 2009 @ 5:33 pm
February 10th, 2009 at 5:39 pm
Provan,
Please read Popper's Logic of Scientific Discovery before ever posting here again.
Comment by chunkdz — February 10, 2009 @ 5:39 pm
February 10th, 2009 at 5:46 pm
Comment by Zachriel — February 10, 2009 @ 5:46 pm
February 10th, 2009 at 5:54 pm
chunk:
Did you read it? If you agree with Popper's arguments, then you agree that ID is not science.
Comment by Raevmo — February 10, 2009 @ 5:54 pm
February 10th, 2009 at 5:58 pm
Raevmo,
I'm sorry for saying that it's stupid. It's probably very fulfilling for some, and perhaps it fills some need to try to "make sense" of the world around us. So let's leave polemics out of it and just call memetics what it is.
Vacuous pseudoscience that makes Richard Dawkins feel good.
Comment by chunkdz — February 10, 2009 @ 5:58 pm
February 10th, 2009 at 6:01 pm
Zach,
Which part of this did I attribute to you?
Comment by chunkdz — February 10, 2009 @ 6:01 pm
February 10th, 2009 at 6:05 pm
This is rich coming from an ID advocate. "Go sell your snake oil somewhere else, I have monopoly on snake oil in these parts!"
For what it's worth I think the word 'meme' is a useful concept for everyday communication but it is not well enough defined to be used in science.
Comment by Todd Berkebile — February 10, 2009 @ 6:05 pm
February 10th, 2009 at 6:23 pm
Why don't you just explain to me why marketing people discovering what does and doesn't work in jingles doesn't meet Popper's requirements.
Comment by don provan — February 10, 2009 @ 6:23 pm
February 10th, 2009 at 6:37 pm
Zach:
It’s in every definition. Definitions are information after all
It is. There is more to the world than matter and physical laws. The part of the world that is matter and physical laws is natural the same way that notes on a page are natural but the song is supernatural.
I agree unless the breaking of the pencil has some meaning (information content )
That’s your opinion I disagree. How can we tell scientifically who is right?
So am I but like a painting I am supernatural and can not be reduced to matter and physical laws.
peace
Comment by fifth monarchy man — February 10, 2009 @ 6:37 pm
February 10th, 2009 at 6:46 pm
DP
That’s because they are speculation and not hypothesis you raised the straw man that ID said nothing about the designer and I proved you wrong now you are moving the goal posts. There is no pleasing some folks
Multiple designers. Two are participating in this conversation right now.
The two designers in this conversation have different characteristics your point is?
peace
Comment by fifth monarchy man — February 10, 2009 @ 6:46 pm
February 10th, 2009 at 6:51 pm
Provan,
State the hypothesis.
Comment by chunkdz — February 10, 2009 @ 6:51 pm
February 10th, 2009 at 6:59 pm
Berkebile,
You don't need to start a peer reviewed journal to think up a new word for 'ideas'.
Comment by chunkdz — February 10, 2009 @ 6:59 pm
February 10th, 2009 at 7:23 pm
I traced the meme exchanges back to their source as they have drawn much attention. This looks like the start:
DP, Santa Claus is real and his alias is Uncle Sam. Want something for nothing? Line up at the public trough.
Comment by Bradford — February 10, 2009 @ 7:23 pm
February 10th, 2009 at 7:28 pm
Definitions are composed of syllables. That is not the same as saying that consciousness is composed of syllables. You are being patently evasive.
A person breaking a pencil is not a supernatural act.
It has nothing to do with science, but the definition of the terms. Because you are consistently using words in a manner contrary to standard usage I suggested scare quotes or people might misunderstand your meaning. It appears making clear statements of your ideas is much less important to you than to string words together to appear to support your preconceptions.
Comment by Zachriel — February 10, 2009 @ 7:28 pm
February 10th, 2009 at 7:38 pm
Memes are culturally transmissible elements. As such they are easily observed, categorized and studied. That you ascribe the term supernatural to memes doesn't change this. A significant problem with memetics is that most cultural elements are too complex to be resolved to discrete units.
And here you clearly invoke the supernatural. Regardless of the source of a meme, we can still observe, categorize and study their spread and divergence through populations.
Comment by Zachriel — February 10, 2009 @ 7:38 pm
February 10th, 2009 at 7:51 pm
Zach:
Are you just pretending? I just can't tell for sure?
What ?
How is what I said contrary to this definition
1: of or relating to an order of existence beyond the visible observable universe ; especially : of or relating to God or a god, demigod, spirit, or devil
2 a: departing from what is usual or normal especially so as to appear to transcend the laws of nature b: attributed to an invisible agent (as a ghost or spirit)
I seem to recall another conversation in which you accused me of not using the standard definitions. In that case I wasted lots of time proving you wrong only to find that when push came to shove you were only pretending.
I am not in the mood to go through that again
I think I’ve been perfectly clear. It you just don’t think you like what we Christians have to say.
We are used to being misunderstood by your side despite our best efforts it’s par for the course
peace
Comment by fifth monarchy man — February 10, 2009 @ 7:51 pm
February 10th, 2009 at 7:55 pm
Zach,
The discrete units of culture you seek lie within the thoughts and dreams of men. Supernatural.
It's pseudoscience.
Comment by chunkdz — February 10, 2009 @ 7:55 pm
February 10th, 2009 at 8:35 pm
Back in my day, we used to call such things "ideas", or "imitations", or "replications", or "mimics", or "fads", or "traditions", etc. We all know humans take on ideas and concepts from others. What does inventing a new buzz word bring to the table, besides another attempt at self-aggrandizement by Professor D?
Comment by kornbelt888 — February 10, 2009 @ 8:35 pm
February 10th, 2009 at 8:47 pm
Without defining "supernatural", this sentence is meaningless.
But assuming you mean something like, "something beyond any conceivable physical process, and yet imposes on spacetime", actually, it is unknown to what degree this is true. If human consciousness is supernatural (and this is still an open question within science) and has will to cause a chain of effects leading to a pencil breaking, then the deliberate of breaking pencils would be a supernaturally caused event.
Comment by kornbelt888 — February 10, 2009 @ 8:47 pm
February 10th, 2009 at 9:08 pm
This is your claim.
The definition of supernatural does not include saying that the conscious mind is supernatural. That may be your presupposition. That may be your belief. But that is *not* part of the definition. You have yet to correct this.
Then you compound the silliness by confounding the characteristics of the definer with the definition. You have left this uncorrected too.
Transmission of memes can be defined empirically. You have repeatedly ignored this point.
Comment by Zachriel — February 10, 2009 @ 9:08 pm
February 10th, 2009 at 9:10 pm
Why do new words ever enter the common vernacular? Because they have some specific connotation that people find useful. A meme is not just an idea, a meme is not an imitation, a fad, a mimic, or a tradition. It is a very specifically different word with a unique meaning. It specially connotes the idea of transferable cultural information.
Comment by Todd Berkebile — February 10, 2009 @ 9:10 pm
February 10th, 2009 at 9:13 pm
If anything caused by a supernatural mind is also supernatural, then as God causes everything, everything is supernatural. This renders the distinction moot. But when people use the term supernatural, they *are* drawing a distinction. God may call the lightning, but the lightning is part of the natural world.
Comment by Zachriel — February 10, 2009 @ 9:13 pm
February 10th, 2009 at 9:19 pm
Fmm is a big fan of defining things into existence, by defining everything as supernatural he can define his a priori supernatural assumptions as correct.
Comment by Todd Berkebile — February 10, 2009 @ 9:19 pm
February 10th, 2009 at 9:21 pm
Todd
If a conscious mind is not reducible to natural law and matter it is according to the standard dictionary definition supernatural. In not sure How I (or Webster)could be more clear.
If information is not reducible to natural law and matter then definitions are according to the standard dictionary definition supernatural. In not sure How I (or Webster)could be more clear.
The fact is the majority of the world believes that both conscious minds and information are not reducible to natural law and matter.
How could you prove us wrong scientificly?
Peace
Comment by fifth monarchy man — February 10, 2009 @ 9:21 pm
February 10th, 2009 at 9:31 pm
fmm:
There is no evidence that the conscious mind is not reducible to natural law.
There is no evidence that information is not reducible to natural law.
Which tells us nothing about the correctness of that belief.
Things are not right by default until proven wrong, things are unknown by default until proven right or wrong.
Comment by Todd Berkebile — February 10, 2009 @ 9:31 pm
February 10th, 2009 at 9:41 pm
Zach,
I hereby acknowledge it. We can track jingles.
Meanwhile, memetics still has made no testable empirical predictions.
Pseudoscience.
Comment by chunkdz — February 10, 2009 @ 9:41 pm
February 10th, 2009 at 9:44 pm
Berkebile,
And things that cannot be touched, seen, heard, tasted, touched, measured, observed etc. are supernatural. Stop being obtuse.
Comment by chunkdz — February 10, 2009 @ 9:44 pm
February 10th, 2009 at 9:45 pm
Zach
You’ve put your finger right on the distinction. The part of lighting that can be reduced to law and matter is natural, The part that can not be (Gods call) is supernatural.
The problem is that folks on your side think that the lighting in total can be reduced to law and matter with no mention of The God who called it.
This is the category error of Scientism.
That’s what makes your ”science” un like the science of folks like Newton so weak.
peace
Comment by fifth monarchy man — February 10, 2009 @ 9:45 pm
February 10th, 2009 at 9:55 pm
Todd:
That conscious minds and Information are supernatural has been proven to the satisfaction of me and the majority of the world but I can't force you to believe the obvious or to publicly admit what you know to be the truth.
So we are at an impasse. Can your “science” tell us who is right?
peace
Comment by fifth monarchy man — February 10, 2009 @ 9:55 pm
February 10th, 2009 at 9:57 pm
Your statement is a non sequitur. I have not challenged the provided definition of supernatural. I am not denying that non-empirical implies supernatural, but you have not shown evidence of any phenomenon that mets this definition. You and fmm are simply assuming that the term supernatural applies to various phenomenon.
Comment by Todd Berkebile — February 10, 2009 @ 9:57 pm
February 10th, 2009 at 10:05 pm
Once again you accuse me of dishonesty. So blinded are you by your convictions that you must believe a person would need to lie to disagree with you. Proving god to your satisfaction didn't require any evidence, you accepted it a priori to start with, so this really isn't an impressive claim.
Science can tell us how the mind works, and continues to make strides doing exactly that. What have we learned from assuming the mind is supernatural? Science cannot disprove the supernatural, that's not its concern, but it can leave us with less and less need to accept any mystical a priori conclusions.
Comment by Todd Berkebile — February 10, 2009 @ 10:05 pm
February 10th, 2009 at 10:12 pm
No, not by definition.
Workable.
By correcting the original statement, and by not trying to defend or deflect from it.
Quite the concession.
I flatly reject the belief that only scientific knowledge is of value.
Comment by Zachriel — February 10, 2009 @ 10:12 pm
February 10th, 2009 at 10:29 pm
Todd,
I was talking about thoughts. Thoughts are supernatural.
Comment by chunkdz — February 10, 2009 @ 10:29 pm
February 10th, 2009 at 11:01 pm
Todd:
.
This is not true. I have undeniable proof that you are suppressing the truth. You might not like it but that's how it is.
Rom 1:18-20 For the wrath of God is revealed from heaven against all ungodliness and unrighteousness of men, who by their unrighteousness suppress the truth. For what can be known about God is plain to them, because God has shown it to them. For his invisible attributes, namely, his eternal power and divine nature, have been clearly perceived, ever since the creation of the world, in the things that have been made. So they are without excuse.
See above
have a good day
peace
Comment by fifth monarchy man — February 10, 2009 @ 11:01 pm
February 10th, 2009 at 11:10 pm
Why do you keep bringing up metaphysics? Dawkins is free to presuppose whatever he wants to presuppose. Frankly although I disagree with his metaphysics I have no problem with his metaphysics. Who knows he may be right and I may be wrong. My problem is not with Dawkins metaphysics, my problem is his science that he uses to disguise his metaphysics and scientific types like you that swallow his metaphysics as science hook line and sinker.
In denial about what ? That ideas get passed along from generation to generation?
Dawkins claims that memes have a physical structure like genes. All I am asking for is where I can see, like we can see a gene under a microscope, these memes he speaks of. Instead of directing me to where I can see these memes you sqeal like a stuck pig and launch into a discussion about my motives.
Furthermore to say that the meme is the Lords prayer as evidence that a meme exists as a physical structure is absurd!!! Thats like saying genes exist and are the reason why my eyes are blue. When someone asks "well show me the evidence for the existence of the gene" you say "well the evidence is you have blue eyes"!!!
Sheesh do you realize how silly this makes you look?
Evidently not because you keep repeating this so called evidence over and over again as if you are actually conveying something of significance.
Vivid
Comment by Vividbleau — February 10, 2009 @ 11:10 pm
February 10th, 2009 at 11:11 pm
I deny your proof, that alone proves your proof is not undeniable.
I don't think 'someone wrote it in a book a long time ago' is a good yard stick for measuring truth either.
Comment by Todd Berkebile — February 10, 2009 @ 11:11 pm
February 10th, 2009 at 11:12 pm
Todd:
Do you know the difference between a mind and a brain? The fact that you use the term "Mind" when you mean "brain' is evidence that you are presupposing your view.
The brain Duh
Apparently not as witnessed by your choice of terms.
It seems it is enhancing the need to rely on priori conclusions at least in your case
Peace
Comment by fifth monarchy man — February 10, 2009 @ 11:12 pm
February 10th, 2009 at 11:12 pm
That is an assumption that you make. I do not make the same assumption.
Comment by Todd Berkebile — February 10, 2009 @ 11:12 pm
February 10th, 2009 at 11:17 pm
I told you exactly where to look, you seemed to ignore that. Meme's are stored in many forms: written in books, recorded on CDs, encoded in weighted neuron graphs. We can study all of those storage mediums.
Comment by Todd Berkebile — February 10, 2009 @ 11:17 pm
February 10th, 2009 at 11:22 pm
Todd:
Your denial is proof that the proof is undeniable. How’s that for a Godel sentence.
It is undeniable that at least some Godel sentences are true and you can’t prove which are and which are not, empirically at least.
stew on that for a while
peace
Comment by fifth monarchy man — February 10, 2009 @ 11:22 pm
February 10th, 2009 at 11:23 pm
fmm:
I do not know that there is a difference between the mind and the brain, neither do you. You seem to assume they are different, I make no such assumption.
Sorry, I'm not following you. By not assuming a priori the conclusion that the mind and brain are dualistically distinct I am guilt of an a priori conclusion?
Comment by Todd Berkebile — February 10, 2009 @ 11:23 pm
February 10th, 2009 at 11:25 pm
As always you simply offer word games with no substance.
Comment by Todd Berkebile — February 10, 2009 @ 11:25 pm
February 10th, 2009 at 11:29 pm
.
You told me where to look and I looked there and what was there were dentrites and axons. You went on to say that at this present moment we do not have technologically sophisticated enough scanners to see them but hopefully some day we would see them. Sort of like "the checks in the mail" So no you have not shown me any physical structures of memes.
However I must give credit were credit is due. You at least, unlike Don, understand Dawkins memes. To your credit you actually presented a possible empirical confirmation of Dawkins memes.
Vivid
Comment by Vividbleau — February 10, 2009 @ 11:29 pm
February 10th, 2009 at 11:45 pm
Todd says:
However even though a "meme" is not well enough defined to be used in science he can scientifically tell me where to see one.
I couldnt make this comedy of errors up if I tried
Vivid
Comment by Vividbleau — February 10, 2009 @ 11:45 pm
February 10th, 2009 at 11:55 pm
It's not an assumption. It's simply what we call things that can't be touched, measured or observed.
Comment by chunkdz — February 10, 2009 @ 11:55 pm
February 11th, 2009 at 12:00 am
Exactly. We know a lot about how information could be stored in the brain, but we don't know yet if the concept of a 'meme' is scientifically useful. The term 'meme' would first need to be more rigorously defined.
Comment by Todd Berkebile — February 11, 2009 @ 12:00 am
February 11th, 2009 at 12:01 am
Thoughts can be measured and observed.
Comment by Todd Berkebile — February 11, 2009 @ 12:01 am
February 11th, 2009 at 12:05 am
There are two issues which appear to be conflated.
The first is whether memetics is a science. Some scientists believe it is, or could be, while others do not. The issue is debatable, with legitimate arguments on both sides.
The second is this claim of what can be called "supernatural." As I understand it, it boils down to whether information is supernatural. If we can agree that computers do not manipulate the supernatural or operate by means of the supernatural, that seems to throw out the information=supernatural idea.
Comment by terrycvn — February 11, 2009 @ 12:05 am
February 11th, 2009 at 12:06 am
What are their dimensions?
Comment by Bradford — February 11, 2009 @ 12:06 am
February 11th, 2009 at 12:13 am
Neural connections can be measured by count and structure, neuron activity by voltage and frequency, dendrite-axon connection characteristics by resistance and distance from the neuron center. These are not unusual units of scientific measure.
Comment by Todd Berkebile — February 11, 2009 @ 12:13 am
February 11th, 2009 at 12:17 am
Todd:
Where are your mappings of neural connection etc. measurements and the thoughts they signify?
Comment by Bradford — February 11, 2009 @ 12:17 am
February 11th, 2009 at 12:18 am
I am not asking about how information is stored in the brain I am asking to see the physical structure of a specific meme, like we can isolate a particular gene or genes that codes for blue eyes. Dawkins defines 'belief in God" as a meme why is this not defined rigorously enough? Provan defines a meme as "The Lord Prayer". Same question.
Vivid
Comment by Vividbleau — February 11, 2009 @ 12:18 am
February 11th, 2009 at 12:28 am
Can you describe the 'belief in God' meme as stored in the internet? We know that it is in there; people discuss god and faith every day on the internet. We can find specific examples easily enough too. But can you show me what 'belief in God' "looks like" as a storage pattern in the internet? We know that each bit of internet storage is physical and we understand how each physical bit works and we understand how they are all connected together but that doesn't make it easy to describe in a holistic way what that pattern looks like across the entire internet. Would you say the internet does not contain the 'belief in god' meme simply because you cannot provide a complete holistic description of the internet? Would you say the internet is 'supernatural' because we cannot provide that holistic description?
Comment by Todd Berkebile — February 11, 2009 @ 12:28 am
February 11th, 2009 at 12:33 am
In every fMRI image. Imagine an fMRI accurate enough to image individual molecules, how much more would that show verse the primitive fMRI's we have today? And yet with today's fMRIs they can already read the image you're seeing from a scan of your brain (see Mind Reading with Functional MRI).
Comment by Todd Berkebile — February 11, 2009 @ 12:33 am
February 11th, 2009 at 12:35 am
I didn't meant to imply (as you apparently inferred) that the proximate cause is supernatural. Rather the ultimate cause in a chain of causation, and not leading back to the big bang, but an immediately supernaturally caused chain of events. If consciousness is supernatural, then deliberately wiggling your finger is evidence of a very recent miracle.
Comment by kornbelt888 — February 11, 2009 @ 12:35 am
February 11th, 2009 at 7:55 am
Todd, in your link Ken Norman states that directly testing theory about the transformation of information could occur by measurement of what information is stored in different parts "and how that changes from structure to structure." MRI may have uses in measuring neural changes and correlating them to information. This is a long way from mapping physical structures to thoughts or stored information. What we witness are very general correlations involving brain states.
Comment by Bradford — February 11, 2009 @ 7:55 am
February 11th, 2009 at 8:40 am
The question is whether objects created by a supernatural mind are thereby supernatural as claimed above. If so, then as God made everything and everything is supernatural, the distinction that most people draw by using the term is rendered moot (meaning our use of the word is non-standard and liable to be misunderstood).
Is an advertising jingle supernatural?
Comment by Zachriel — February 11, 2009 @ 8:40 am
February 11th, 2009 at 10:26 am
I agree. Which is why I advocate against it.
Regardless of the definition of supernatural, a jingle is not proximately supernatural. If the human consciousness involved is supernatural, then the jingle has, at least partially, an indirect supernatural cause.
Comment by kornbelt888 — February 11, 2009 @ 10:26 am
February 11th, 2009 at 10:39 am
You are absolutely correct, I specifically pointed out how primitive our current tools compared to what they might become. We must learn to crawl before we can run a marathon. But this is certainly an important step towards better understanding of the brain and it does strongly indicate that particular thoughts are associated with particular brain structures.
Comment by Todd Berkebile — February 11, 2009 @ 10:39 am
February 11th, 2009 at 10:49 am
Bradford:
Maybe not such a long way. From Todd's link:
It's hard to deny with a straight face that it really seems as if memory of pictures is entirely physically encoded in the brain. You could still argue that it's also encoded in some non-physical medium (the "soul"), but where's the evidence for that?
Comment by Raevmo — February 11, 2009 @ 10:49 am
February 11th, 2009 at 11:35 am
That one day we'll be able to know what a person is thinking about based on a scan of their brain is a position taken by those known and ardent materialists, Richard Swinburne and Plantinga. I'm sure someone could argue about the 'entirely', but the questions of limitations about purely physical explanations of mind center around other issues. Intentionality, qualia, etc, with the first being very interesting due to the philosophical fallout that's surrounded its (mostly) modern discussion.
Comment by nullasalus — February 11, 2009 @ 11:35 am
February 11th, 2009 at 11:38 am
From the link: When volunteers were later shown a new image not included in the first set, the computer model was able to correctly predict which picture out of 120 or 1,000 possibilities the person looked at with 90 or 80 percent accuracy, respectively.
That's a primitive perceptual link cited. My wife is in the field of radiology and I'm quite familiar with the function and limitations of MRI. That said the evidence for the non-physical mind is evident in our thought processes. It's a constant reminder.
Comment by Bradford — February 11, 2009 @ 11:38 am
February 11th, 2009 at 12:01 pm
nullasalus:
Excellent.
Comment by Raevmo — February 11, 2009 @ 12:01 pm
February 11th, 2009 at 12:07 pm
Bradford:
How nice. But if MRI is still quite "primitive", that makes it even more impressive to me that with 80-90% accuracy a computer model can infer from brain images what picture out of many a person is thinking about.
That's not exactly objective evidence that we can agree on. It's more like your personal view, partly based on wishful thinking regarding your future or lack thereof after death.
Comment by Raevmo — February 11, 2009 @ 12:07 pm
February 11th, 2009 at 12:23 pm
So says someone who is clearly deluded about their own mental states due to irrational dislike of ideas presumed to be religious. Boy, these discussions sure get easy when we whip out the psycho-analyzing!
You seem to be under the impression that the views of people who believe in souls – or even just those who deny that the mind can entirely be explained in terms of the physical – requires that there be absolutely no connection between mind and brain/body, such that evidence like 'There are reports that people without eyes are unable to see' counts as evidence against their views. It's a very popular strawman, but a strawman nevertheless.
Comment by nullasalus — February 11, 2009 @ 12:23 pm
February 11th, 2009 at 12:23 pm
There's no surprise in any of this. Try describing what brain images would look like for analytical exercises and then derive predictions about conclusions reached. If brain images are identical for analytical routes to contradictory conclusions materialism has a problem.
Thoughts lead to consequences about which we can make predictions without any knowledge of brain states. Materialism is your wishful thinking.
Comment by Bradford — February 11, 2009 @ 12:23 pm
February 11th, 2009 at 12:59 pm
nullasalus:
Well, you're wrong — I'm not under that impression. Rather, I'm under the impression that gaps in our knowledge about the workings of the brain are used to deny the possibility that the mind can entirely be explained in terms of the physical, which is par for the course for the likes of Bradford (see above for example).
Comment by Raevmo — February 11, 2009 @ 12:59 pm
February 11th, 2009 at 1:17 pm
So, let me get this straight. There are people who believe (often on philosophical grounds that divide even physicalists into multiple, exclusive camps) that the mind can't be explained entirely in terms of the physical. And your complaint is that they point to a lack of satisfactory explanation of mind in terms of the physical as supporting their case? C'mon.
Again, the idea that eyes are needed for sight (and the like) isn't exactly news with regards to those varied philosophical schools. Hell, there are physicalists who admit that things like self, intentionality, and otherwise will never and can never be explained in terms of the physical. How they cope with that is interesting to say the least.
Correlating fMRI to information doesn't land so much as a glancing blow against even fairly wild cartesian dualism, much less the other varieties. If you're not under the impression I said, why would not being impressed with such results tweak you?
Comment by nullasalus — February 11, 2009 @ 1:17 pm
February 11th, 2009 at 2:24 pm
There is some objective evidence (all be it far from conclusive) that the mind is purely physical. There is no objective evidence that the mind cannot be purely physical.
Even our instinctive impression of dualism is easily explained by the physical structure of our brains (the mammal brain being wrapped around a largely separate lizard brain).
Comment by Todd Berkebile — February 11, 2009 @ 2:24 pm
February 11th, 2009 at 2:28 pm
Todd,
Not exactly. The study you cited, and many others (see Quiroga et. al. Nature, 2005) are able to correlate visual stimulus with particular neuronal firing. So much so that they can predict what the subject is viewing. However, the same is not true when a subject merely "thinks" about something. The neuron that fires when an image of Halle Berry is displayed will not necessarily fire when the subject only thinks about Halle Berry. So we are likely seeing memory recall, not actual thoughts.
There is one interesting caveat, though. The Halle Berry neuron is not just correlated to a particular image of Halle Berry, but to Halle Berry dressed as Catwoman, or even the letters H-A-L-L-E-B-E-R-R-Y. The neurons are apparently memory repositories for abstract concepts – which would get Todd one step closer to actually following a meme from it's inception. We can observe an abstract concept, but we can not yet actually observe a thought.
Given this, I can understand Todd's excitement about the future and the possibility to read thoughts. But it's simply too premature to claim that we are actually observing thoughts in action. It's more likely we are seeing stimulus and memory retrieval. Thought still remains in the realm of the supernatural.
Comment by chunkdz — February 11, 2009 @ 2:28 pm
February 11th, 2009 at 3:37 pm
This may or may not be true, but that's a different claim than consciousness being purely physical. There's no scientific evidence for that. The only evidence that exists, at best, is correlated brain states to what is reported by the subjects. And even then, there's no way to know if a given subject is conscious or is a philosophical zombie.
Nope. Not a shred.
Comment by kornbelt888 — February 11, 2009 @ 3:37 pm
February 11th, 2009 at 4:00 pm
nullasalus:
I would formulate it differently. My complaint is that they reject that for which there is positive evidence in favor of that for which there is no positive evidence. It is classical God-of-the-gaps reasoning without any explanatory power whatsoever.
It is for some people, like those claiming to have seen while having an "out-of-body" experience. But I fail to see the relevance of this.
Again, how is this relevant?
Comment by Raevmo — February 11, 2009 @ 4:00 pm
February 11th, 2009 at 4:15 pm
Raevmo:
I would formulate it differently. My complaint is that they present data for different brain states as conclusive evidence that the mind is a physical construct. It is classical materialism-of-the-gaps reasoning which confuses minds with mechanical constructs.
Comment by Bradford — February 11, 2009 @ 4:15 pm
February 11th, 2009 at 4:22 pm
Bradford:
Who presents it as conclusive evidence? Or are you just making that up?
Comment by Raevmo — February 11, 2009 @ 4:22 pm
February 11th, 2009 at 4:26 pm
So the matter is an open question. That brings up the issue of what evidence would be supportive of the opposing camps. Bring it on.
Comment by Bradford — February 11, 2009 @ 4:26 pm
February 11th, 2009 at 6:16 pm
Yes, the 'materialistic' predictions are all falsifiable. That is their strength compared to dualistic assumptions.
There is no evidence that consciousness exists apart from the brain. If the brain is purely physical then consciousness could just as easily be purely physical.
Comment by Todd Berkebile — February 11, 2009 @ 6:16 pm
February 11th, 2009 at 6:29 pm
Todd, dualism would have a different model which would allow for falsification.
Comment by Bradford — February 11, 2009 @ 6:29 pm
February 11th, 2009 at 6:43 pm
Physical models of the brain can be supported by brain scanning techniques like the article I linked previously. They can be supported by experiments like the one where live brain cells were grafted to a computer chip and used to store and retrieve data. They can be supported by computer modeling of the brain. Specific hypothesis such as the Memory-Prediction Framework are falsifiable by these exact same methods too.
What would that dualistic model be? How can dualism be falsified?
Comment by Todd Berkebile — February 11, 2009 @ 6:43 pm
February 11th, 2009 at 6:43 pm
Bradford:
You don't get away with it so easily. You claimed that evidence is presented as conclusive for the proposition that the mind can be explained entirely in terms of the physical. Can you back up your claim, yes or no?
Comment by Raevmo — February 11, 2009 @ 6:43 pm
February 11th, 2009 at 6:49 pm
Raevmo,
Complete nonsense. These are philosophical questions that science informs – whatever 'positive evidence' exists can be accounted for equally well, often better, via dualist understandings of mind as by physicalists. Which is why there's really only one side here with a knack for doing things like denying that beliefs, selves, qualia, and other mental aspects exist – and that wouldn't be the dualists.
Because you're suggesting that dualists of all stripes reject scientific data when it's manifestly not the case? And you're strongly implying that if it's determined that eyes are needed for sight, that's somehow data that can support physicalist – and only physicalist – explanations of the mind. If so, you're either vastly confused or purposefully being deceptive here.
You're the one comparing the dualists to the physicalists, claiming that 'they reject that for which there is positive evidence in favor of'. Hey, is there positive evidence in favor of selves and beliefs? Do you understand what commitment you're making when you're playing the game of 'the only evidence we should accept on this question is strict results of empirical science'? By all means, say that's not the position you're taking. But then you have little room to bitch at dualists in. You can disagree with them – hey, I disagree with some dualists, since there's a variety of positions – but that and a quarter will get some gum.
Comment by nullasalus — February 11, 2009 @ 6:49 pm
February 11th, 2009 at 7:07 pm
A mechanistic model should show different brain states for different, specific modes of thought. Same states for different thoughts would at the very least show mappings to be trivial for a mechanistic model. If the two (brain states and mind) are independent but interacting entities then there would be an expectation that distinct brain states encompass a variety of differing thought modes. Brain states would include arrays of general thought patterns rather than specific one to one mappings.
Comment by Bradford — February 11, 2009 @ 7:07 pm
February 11th, 2009 at 7:13 pm
nullasalus:
What positive evidence is there for dualism then? No need to bring up stuff that other people deny but I don't.
I'm not suggesting at all that all dualists reject scientific data, and I'm not implying at all that eyesight somehow rejects non-physicalist explanations.
It's up to the dualists to support their claim that there is more to the mind than the physical. So far they have failed and I will stick with the physical for the time being. And indeed I do claim that this question can only be settled by means of empirical evidence.
Comment by Raevmo — February 11, 2009 @ 7:13 pm
February 11th, 2009 at 7:24 pm
"Jingles with predominately raising major scales make people feel better about the associated product than jingles which use minor scales or are predominately descending."
Comment by don provan — February 11, 2009 @ 7:24 pm
February 11th, 2009 at 8:14 pm
Raevmo,
No, there's definitely a 'need to bring up stuff' like that. If you're going to limit discussion to positive evidence – and I'm going to assume positive evidence is going to be strictly limited to third-person empirical data – then you're in one hell of a problematic position considering "stuff that other people deny but you don't". Your position is more gappy than even the most aggressive substance dualist at that point.
Alright, so we have physicalists and dualists. The physicalists believe the mind is entirely accounted for by the physical (though one considerable chunk of them end up at least strongly appearing as dualists of at least the property variety and more.) The dualists believe that while there's a physical aspect to mind, even a physical necessity for mind (Despite 'physical' meaning less and less nowadays), a complete description will need to make reference to the immaterial – and this ranges from distinct cartesian substances to final causes and inherent powers to otherwise. However, from the outset, no reference to the immaterial is allowed in support of their claims. Your definition of 'fail' in this context is giggle-worthy.
But hey – have fun choosing between whether to adopt the mysterian perspective, or trying to figure out if you actually exist a la Blackmore.
Comment by nullasalus — February 11, 2009 @ 8:14 pm
February 11th, 2009 at 8:43 pm
Within the radiance of my own consciousness there is absolute evidence that I exist apart from the brain. You really need to learn to speak for yourself. Now, I think what you mean to say is that there is no scientific evidence for that. I certainly agree, given that it's entirely outside of the purview of science. That you are unaware of this is entirely your problem.
And if pigs start flying, why then, pigs can fly.
Comment by kornbelt888 — February 11, 2009 @ 8:43 pm
February 11th, 2009 at 8:46 pm
I asked nullasalus:
And the answer is:
So no positive evidence for dualism then? Try again please.
When you make assertions that my position is problematic and gappy, it might be more convincing if you actually tried to support your assertions. Look, I can do that, too: your position is problematic and gappy. See how unconvincing that is?
More unsupported assertions. Since when do "the dualists" believe that there is a physical necessity for mind? I could have sworn that plenty of dualists believe that a mind can exist without a physical manifestation.
And again an unsupported assertion. Why, pray tell, is there a need to refer to the immaterial?
Comment by Raevmo — February 11, 2009 @ 8:46 pm
February 11th, 2009 at 9:00 pm
So it seems like you are proposing a hypothesis based on a naturalistic explanation and then claiming dualism is supported if this particular naturalistic explanation turns out to be false. Unfortunately disproving a particular physical explanation does nothing to prove a dualistic explanation. I guess you personally might be willing to abandon the dualistic view if it turns out that thoughts do map one-to-one, but that hardly seems to falsify dualism. It is telling, however, that once again the super natural can only be hinted at by first failing to find a natural explanation.
Comment by Todd Berkebile — February 11, 2009 @ 9:00 pm
February 11th, 2009 at 9:11 pm
What is that evidence? Is it just your intuition? Or is it that within your mind anything you believe to be true must be true? Is it impossible for your mind to experience anything that is not complete truth?
I assume we both experience consciousness in the same way. I feel like there is a 'me' in my head which is often conceptualized as a voice independent from my physical form. This is a very powerful emotion that is undeniable. I just don't see why that sensation requires a non-natural explanation. We think and feel exactly what we think and feel regardless of whether dualism is true or false.
Comment by Todd Berkebile — February 11, 2009 @ 9:11 pm
February 11th, 2009 at 9:14 pm
Raevmo,
Wonderful, Raevmo. Care to provide some positive evidence for beliefs, qualia, intention, universals, and otherwise? By all means, let's see it. Fail to provide evidence for these things – better yet, evidence for these things and proof that they're physical in nature – and guess what? You're dealing in gaps. My guess is you'll belch out, 'Umm, brains are made of matter' as proof, while forgetting that dualists can happily cede that and every connected scientific discovery that goes with it while their positions remain untouched.
You're asking me to provide support for the immaterial using only material and empirical evidence. And providing arguments the material can't account for familiar first-person experience even in principle won't work either, because you claim it's the stuff of gaps. Meanwhile, you don't want me to bring up 'stuff others deny but you don't' – hell, you don't even want to recognize that some committed physicalists believe they have to jettison certain things you take for granted. That, somehow, is unfair.
My assertions aren't unsupported. Yours, however, are flat-out uninformed.
I wonder if it could be because your knowledge of dualism has more to do with catching Ghostbusters on TV a couple times than actual experience with the positions? If you think dualism is completely comprised by the idea that the phenomenal doesn't change after brain death – hell, if you aren't aware that there are dualist proposals that see brains/bodies as necessary for the experiential – congratulations. You're as ignorant on this topic as I guessed. And that assertion is amply supported by this thread.
It's not unsupported, Raevmo. It's a description of the rules you laid down here. I can provide the philosophical arguments, but oh wait – you don't want to deal in philosophy. You only want evidence, and that evidence has to be material. It's a circular farce. But I'm willing to let it drag out, because I'm trying to figure out if you're dishonest or simply ignorant. It's hard to tell – the positive evidence can go either way.
Comment by nullasalus — February 11, 2009 @ 9:14 pm
February 11th, 2009 at 9:35 pm
Whatever it is I'm perfectly happy with the understanding that you will probably always view the subject the way you do now.
Did I say "mind"? I'm talking about consciousness.
I do not assume this at all. In fact, I strongly suspect that we do not, given what you've said, which is all I have to go on.
I understand that you don't see why. I can live with that.
Said the blind man as he tries to persuade the sighted man that the color blue is an "illusion."
Comment by kornbelt888 — February 11, 2009 @ 9:35 pm
February 11th, 2009 at 9:43 pm
Then your data is useless in proving anything relevant to this issue. If one brain state correlates to 1,000 separate thought patterns then no distinctive hypothesis is evident. Anything will support your point. And why should physically identical states correlate to differing thoughts? That's counterintuitive in addition to not making any distinctive point. OTOH, if minds are interactive but also semi-autonomous from underlying brain cells then distinctiveness within physical boundaries would make sense. The cause would be attributed to the mind rather than a physical entity.
Why do you find this surprising? The prefix super in front of natural is intended to convey the idea that the natural is a measuring stick for the supernatural. That's why evidence for a deity has traditionally included a capacity to exceed the boundaries of nature.
Comment by Bradford — February 11, 2009 @ 9:43 pm
February 11th, 2009 at 9:46 pm
The word "blind" is meaningless in universe without eyes.
Comment by kornbelt888 — February 11, 2009 @ 9:46 pm
February 11th, 2009 at 10:45 pm
I must not have been clear, I was not trying to contradict your proposed method or challenge its merit. I was merely pointing out that your proposed method involved making one specific materialistic prediction and then falsifying it. I agree that current physical models expect to find the sort of correlations you mentioned, I just don't see how that correlation being true or false tells us anything about dualism. Dualism fits any possible result, just look at null's recent post:
Comment by Todd Berkebile — February 11, 2009 @ 10:45 pm
February 12th, 2009 at 12:06 am
Provan,
The whole idea of falsification, Don, is that we should be able to eliminate a hypothesis if we get a certain result. The prediction should be risky, and a false result devastating. Neither is true in your case.
Your hypothesis is way to vague to be considered scientific. Your empirical metric is "feeling good" for Pete's sake.
There is also a subjective element to your hypothesis that would make Popper cringe. Black Sabbath's "Iron Man" would be completely appropriate for an "Iron Man" action figure. Play the song in a major key, however, and kids will roll their eyes and laugh their asses off. I don't suppose that's what you meant by "feeling good" is it?
Go read Popper Don. It'll be good for you.
Comment by chunkdz — February 12, 2009 @ 12:06 am
February 12th, 2009 at 8:57 am
nullasalus:
I will gladly give it a try, if you provide me with your preferred definitions of those terms, so you can’t accuse me later that I am attacking strawman versions of them.
There will always be gaps in knowledge. What else is new? The question is how to deal with those gaps. Many on this board argue fallaciously that such gaps are evidence for non-physical aspects of the mind, which they are not. Absence of evidence is not evidence of absence. How many times have we not seen in the past that claims of the non-physical have been successfully replaced by mundane physical explanations? In this very thread we have considered an example: mental images that can be read by a computer. I’m glad I don’t have to feed all the deluded who believe that memory is not stored in the brain but in some non-physical aspect of “the mind”. I think it’s perfectly reasonable to extrapolate this trend and to expect that more and more aspects of the mind will yield to a physical explanation. Indeed, it’s happening as we speak.
I’m amused you admit that the position of dualists is untouchable (haha) by any amount of scientific evidence, which just goes to show how dogmatic their position is.
If your position can only be supported by philosophical arguments – and not by any empirical evidence – then it’s an incredibly weak position. That which can be claimed without evidence can also be dismissed without evidence. But by all means, I’d be happy to see you demonstrate how the material can’t account for familiar first-person experience even in principle.
You’re pretty bad at guessing. It’s embarrassing. But if inventing caricatures makes you feel good, have at it.
Happy Darwin Day!
Comment by Raevmo — February 12, 2009 @ 8:57 am
February 12th, 2009 at 10:24 am
Feelling good about a product is testable, for example with focus groups. Also, such a test may only reveal a tendency and not a perfect correlation.
Interesting counter-example, a meme associated with revenge and destruction.
In any case, a better example concerns how memes are actually transmitted. Of course, it's a complex subject and not always resolvable to the particulate as proposed by memetic theory. With verbal memes (which are easily tested with the game of Whispers), we know that familiar topics and short rhythmic motifs are more likely to be transmitted intact. Long gossipy prose tends to mutate more rapidly with details being compressed and embellishments being added.
Comment by Zachriel — February 12, 2009 @ 10:24 am
February 12th, 2009 at 12:27 pm
The eliminated hypotheses would be that ascending major scales are bad for products. A false result would change jingle writing extensively.
You asked for just a scientific hypothesis, not a really good scientific hypothesis. Anyone can take my example and see that there are far more scientific hypotheses that could be constructed along the same lines than my simple example designed to be easy to understand rather than be a risky new line of marketing research.
Gee, I'm not sure. We should test your scientific hypothesis about the "Iron Man" meme empirically.
Comment by don provan — February 12, 2009 @ 12:27 pm
February 12th, 2009 at 12:33 pm
Raevmo,
I'll settle for the versions most commonly discussed in the relevant literature at plato.stanford.edu.
The only fallacious argument that have been presented in this thread is your suggesting that any physical explanation for some aspect of the brain is always support for a materialist explanation, and always a knock against a dualist explanation. As I said – it's all Ghostbusters. A caricature.
What's more, you're purposefully confusing any gaps in knowledge about the brain at all with dualist contentions about what can't be done in a physical medium even in principle – about what even many physicalists will admit likely cannot be done even in principle. So we're back to 'that eyes are necessary for sight is proof against dualism' nonsense.
If you want to talk dogma, I suggest you take a look at the physicalists who are already gearing up to throw selves, beliefs, truth, and other such inconvenient propositions over the rails in expectation that no material explanation will ever be sufficient to save those things. Of course, there's also the mysterians who are try to keep those things while admitting it will forever be a mystery – but darnit, they know in their hearts that it's all physical. Meanwhile, the only way you keep yourself out of these camps is by squirming and trying to keep as little attention on your own position as possible.
Of course, I mentioned this already, but you may have already forgotten. Or it was a different Raevmo.
So, I have to back up my claims about the immaterial – but I can only do so by way of material proof. And it can't be arguments about what the material alone can't do even in principle and what it has not been demonstrated to do, because those would be gaps.
Hey Raevmo, provide me with empirical evidence that the holocaust is was objectively wrong. And, since you're a committed physicalist, do so without any reference to immaterial entities. Nothing but science.
I'm dead-on accurate, as your replies are showing more and more. You won't provide empirical evidence for your supposed beliefs that intentions, beliefs, qualia, and otherwise are purely physical. You whine that pointing out your inability to do this is the stuff of gaps, even though you have to rely on gaps to justify your position because of the difficulties of accounting for these things even in principle. And you stick your fingers in your ears when it's pointed out to you that the empirical data strongly comports a plethora of dualist views of the mind.
As usual, you got nothin'.
And to you too – of course, despite all the buildup most people don't or care it's passing today, but this IS a glorious day. Maybe I'll make a post about why.
Comment by nullasalus — February 12, 2009 @ 12:33 pm
February 12th, 2009 at 12:49 pm
You offered speculations in response to my comparison of ID to archeology. Archeological speculations can be confirmed. Your ID speculations cannot, so my statement stands: ID doesn't do anything comparable to the science archeology does.
Now that we've cleared up that question, can we return to what you want to call this difference between a study that generates only unconfirmable speculations and one that generates hypothesis? We've ruled out the "supernatural" mainly because you didn't like it. And now we've cleared up that "speculation" doesn't help because the key difference is in hypotheses, not mere speculations. What's next?
Don't be a jerk. Your list has "the designer" four times and you even used it in what I quoted above, so you can't pretend you don't know what I'm talking about.
Comment by don provan — February 12, 2009 @ 12:49 pm
February 12th, 2009 at 1:13 pm
I brought up Dawkins's metaphysics because this claim reflects that metaphysics, not something core to memes. He is not a dualist, so he thinks all ideas have a physical structure. This not central to the idea of memes, however. Memes only need to have an existence in the mind. A dualist existence partially or entirely supernatural within a non-physical mind is sufficient. Regardless of what the memes existence is in a human mind, we confirm its existence every time we see you replicate your Lord's Prayer meme by reciting it out loud. When you teach it to a child by replicating it repeatedly for him to hear, we then see that it has passed to his mind when he demonstrates its existence there by replicating it in his own recital.
This is the core of your misunderstanding, and I've pointed it out several times: the Lord's Prayer is a meme. When you hear it, you are hearing a meme replicated by being spoken aloud. When you see it written down you are looking at a meme replicated by being writen it down. There is it, right in front of you, a meme, the Lord's Prayer, observable in physical form. The meme in the mind was the source of the replication, but the replica is a also meme itself. I can't make it any clearer than that. Even though we cannot examine the memes directly within a mind, we can deduce a meme's presence there every time the mind replicates it into a physical form.
Comment by don provan — February 12, 2009 @ 1:13 pm
February 12th, 2009 at 1:30 pm
I guess you think this shows that "meme" is a redundant term since we have a bunch of other terms for such things. But you actually show the exact opposite: that Dawkins has identified a class of concepts that previously had no identifying term.
Yes, we know all about them. That's why it's so dang funny that so many telic thinkers are denying the concept when there are millions of examples that they already know about that confirm exactly what he's saying!
Identifying this concept and coming up with a term for it does two things. First, it unifies these uncountable many individual ideas into a single class of things that pass around from mind to mind. "Ideas", "fads", "traditions" we understand as static concepts, but the terms don't convey their transmissions.
Second, it makes us notice that these concepts identify things that take up existence in physical forms outside the mind when they pass between people. Fads don't just happen by magic, they happen because an idea gets physically transported to someone that thinks it's really groovy, so remembers it and acts on it.
An extremely interesting and important observation, well worth enough aggrandizement by us that Dawkins need not add any by himself.
Comment by don provan — February 12, 2009 @ 1:30 pm
February 12th, 2009 at 2:39 pm
Provan,
??? That wasn't even your original hypothesis. And this one is no better than the first.
If "Iron Man" in a minor key made kids feel good, then all you would have demonstrated (inconclusively) was that "Iron Man" in a minor key made kids feel good. It says nothing about your original hypothesis because there are myriad other variables in play. Falsification should absolutely eliminate the hypothesis. Otherwise it's not scientific.
And yours is neither.
Your hypothesis is closer to statistical sampling than a scientific hypothesis. Don, I happen to work with more than my fair share of seven figure hot shot marketing execs and they will all tell you that marketing is more art than science, with a considerable amount of luck involved (although you might have trouble getting them to admit that publicly). It's NOT science, and your hypothesis is not science either. This doesn't mean we can't learn anything about the effect of minor and major scales, but there are far too many variables in play to be scientific. There are a million reasons why someone likes a product or not. The tonality of the jingle is just one parameter.
Compare this with the prediction made by general relativity about light bending around the planet Mercury. Specific, risky, empirical, objective, and if it didn't happen the hypothesis would have been tossed out. That's science. You are merely tracking the subjective whims of a fluid emotional landscape.
This is your problem. You think my anecdote is a scientific hypothesis. It's not.
Go read Popper.
Comment by chunkdz — February 12, 2009 @ 2:39 pm
February 12th, 2009 at 3:07 pm
My example is a hytpothesis that would be studied using statistical sampling. The rest of your complaints hinge on this being a simple example rather than a proposal for a scientific study. It's patendly obvious that the effects of jingles can be studied scientifically, and your appeal to first principles simply shows us that you don't know how to apply what you think you learned by reading Popper.
Your hypothesis — that "Iron Man" in a major key would have a negative impact on sales because much of the target audience would "roll their eyes and laugh their asses off" — can be studied scientifically in order to be confirmed or falsified. Your problem is that you don't understand that any suggested outcome can be turned into a formal hypothesis that would satisfy Popper.
Comment by don provan — February 12, 2009 @ 3:07 pm
February 12th, 2009 at 3:45 pm
Provan,
Fine. But don't call it scientific unless it is falsifiable. It's not.
To the contrary. Your hypothesis is not simple enough.
Not with your hypothesis.
I didn't say anything of the kind. Perhaps the silliness of the song would appeal to a certain demographic. Pat Boone made a lot of money doing a shmaltzy Ozzie cover.
Not if it's not falsifiable.
Comment by chunkdz — February 12, 2009 @ 3:45 pm
February 12th, 2009 at 4:13 pm
Falsification is not always possible through a single observation, especially for statistical predictions. Popper was trying to resolve the problem of induction, but every observation entails theoretical considerations of its own. In any case, it is not reasonable to claim that we can't make certain predictions about the transmission of cultural elements, as can be demonstrated in a simple game of Whispers.
Comment by Zachriel — February 12, 2009 @ 4:13 pm
February 12th, 2009 at 4:32 pm
My hypothesis was falsifiable conceptually. It only lacked specific details such as what, exactly, would constitute "predominately ascending" and "make people feel better about the associated product", but these are clearly things that could be specified with sufficient precision if one felt it necessary to satisfy a particularly dense audience.
Here's what you said:
The only thing I added was the negative impact since that was implicit from the context.
I think you must be missing the point here. I think you're bringing up the "Iron Man" example in some attempt to show that the results of my hypothesis wouldn't hold, which is, of course, silly: I made no claims about whether my hypothesis would actually prove true, I merely presented it as a falsifiable scientific hypothesis about the memes called "jingles". But what I did was turn your example around and show that it was itself a falsifiable scientific hypothesis of the type you asked me to produce, although equally simplified because we haven't specifically defined "laugh their asses off", etc., even though it's clear we could if we were serious about studying the effects of the "Iron Man in a major key" meme on action figure sales.
Well, yes, I suppose, but that would be a different class of "suggested outcomes" than the ones we've been discussing. If we were discussing whether one kind of jingle made God happy, obviously we'd have a problem, but market researchers wouldn't be too interested in that outcome, anyway.
Comment by don provan — February 12, 2009 @ 4:32 pm
February 12th, 2009 at 4:33 pm
Zach,
I never said it had to be a single observation.
The problem with these kinds of qualitative statistics is that you will end up with a lot of correlation and little causation. That's usually adequate for marketing purposes, but not for science.
Comment by chunkdz — February 12, 2009 @ 4:33 pm
February 12th, 2009 at 5:26 pm
chunk:
So what's the cutoff ratio of correlation to causation below which something suddenly becomes science?
Science can test hypotheses about correlations without knowing the underlying causes. For instance, I can test the hypothesis that there is no correlation between the number of storks returning from Africa and the human birth rate.
[for a better example, see Zachriel below]
Comment by Raevmo — February 12, 2009 @ 5:26 pm
February 12th, 2009 at 5:29 pm
That is incorrect. If we show a significant correlation between taking a particular drug and recovery from the specified disease, and this correlation is consistent across multiple tests by other labs under differing conditions, then this is a scientifically valid test of the effectiveness of the drug. A falsification would occur when the other labs cannot verify the correlation. Notice that we don't have to know the mechanism by which the drug works to be considered a valid scientific result (though the mechanism would certainly be of interest for determining long term effectiveness, to reduce side effects, and to extend the effort in the fight against related diseases).
Comment by Zachriel — February 12, 2009 @ 5:29 pm
February 12th, 2009 at 5:51 pm
Provan,
Your hypothesis is not falsifiable. The details you just mentioned are the least of your problems. Your hypothesis is so vague and broad that any number of unquantified factors could affect the outcome. The demographics of your test group, the state of the economy, musical genre, instrumentation, musical key, the product itself and how it's presented, whether the tester had bad breath, time of day, weather conditions, parking. You may not think about such things, but marketing execs certainly do, because they can affect the results of the testing. Come back in a year when the economy is recovered and all other things being equal you will get entirely different results. "Iron Man" will jazz kids up one month, and the very next month it will be the dumbest thing they've ever heard.
That you believe it is a falsifiable scientific hypothesis is troubling.
Comment by chunkdz — February 12, 2009 @ 5:51 pm
February 12th, 2009 at 5:57 pm
DP
You said that ID did not say anything about the designer I proved you wrong now you are bringing up the tired contention that ID does not make predictions are we ever going to talk about anything but straw men
ID does generate hypothesis I’ve come up with two myself.
I could bring them up only to hear you say that they are vague or not sufficiently distinguishing to please you….
Then I would remark that from my perspective it’s Darwinism that fails to come up with any specific predictions that distinguish it from the default position of the majority of the world which is ID
Then you would point out that you don’t care what the majority of the world thinks only those who agree with you that the empirical is the only thing that is important when evaluating theories. bla bla bla.
Been there done that have the tee shirt
Peace
Comment by fifth monarchy man — February 12, 2009 @ 5:57 pm
February 12th, 2009 at 6:02 pm
Zach,
If enough controls are in place, and the prediction is very specific (a disease is cured) then this could be considered scientific.
But it's fairly obvious that in Don's example we'd find that sometimes major keys work, sometimes minor keys work, sometimes neither or a combination of the two work, and that "feeling good" is dependent upon a lot of different factors. In Popperian terms, this is pseudoscience because the experiment has too many variables to be considered falsifiable.
Comment by chunkdz — February 12, 2009 @ 6:02 pm
February 12th, 2009 at 6:37 pm
Some of this is missing detail, left out because it's just an example. Some of this makes the hypothesis difficult to test, but not impossible to test. Some of them are just absurd examples of how badly the testing could be done. None of it makes the hypothesis unscientific.
As you say, someone actually interesting in making such a hypothesis would not only know these factors but would account for them when turning my casual example into an actual research project.
Comment by don provan — February 12, 2009 @ 6:37 pm
February 12th, 2009 at 6:48 pm
OK, obviously we've lost the thread. We were comparing archeology to ID, we weren't discussing ID in general. ID, of course, can and does say all kinds of things about all kinds of things, but none of it amounts to as much as determing whether a wall is man made. I apologize if I gave you the impression that I was interesting in hearing about how ID says the designer has a predetermined goal in mind. Yes, I know ID says that….unless I say it says that, in which case I'm sure someone will say I'm wrong.
OK. I'll just have to wait until ID accomplishes something more than speculation.
Comment by don provan — February 12, 2009 @ 6:48 pm
February 12th, 2009 at 6:57 pm
nullasalus:
No, I didn't suggest that. You're just making that up, apparently because you can't argue with what I really said. What I did suggest was that more and more aspects of the mind that were previously fair game for dualists, such as (visual) memory, have a perfectly physical explanation nowadays. These new findings don't rule out dualism (after all, nothing can according to you), but they do narrow their playing field.
You keep claiming that there are things that can't be done in principle in a physical medium, but so far you haven't given a single reasoned example. Please go ahead, explain what it is that you and so many physicalists think cannot be done in principle, and how is it relevant to our understanding of the mind.
You can back up your claims about the immaterial any way you like. So far you haven't. But if your claims about the mind cannot be verified objectively in any way, then why should I believe you?
There we go again with the holocaust. If all else fails, bring up the morality of the holocaust. That'll show those committed physicalists. We discussed this before. There is no such thing as objectively wrong IMO. Your definition of objectively wrong boils down to: my imaginary friend says it, I believe it, that settles it.
It's you who has nothing I'm afraid.
Comment by Raevmo — February 12, 2009 @ 6:57 pm
February 12th, 2009 at 7:03 pm
I rarely laff at things I read on TT, but this one made me laff out loud.
Oh my God, Dick Dawkins has actually figured out that humans share ideas? Good God Almighty, lets name a day after him.
Happy Darwin day, BTW. (Or was that yesterday?)
You've got to be kidding, right?
Denying what? That humans share ideas and imitate one another? Holy shit, nobody ever thought of that before!
Thank you, oh THANK YOU, Professor D!
Seriously, dude, he's not saying anything that's not obvious to my 9 year old.
You've got to be kidding, right?
Sorry, but the beer is now coming out of my nose. Please STOP IT!
There's something pretty interesting going on here, Don. Pretty… pretty… pretty… interesting. (Said with Larry David grimace.)
Oh my God, someone noticed ideas get physically transported between people. I never knew that until now! I nominate the good Prof D for a Nobel prize. He must be the first person to have ever noticed that. Wow!
When Dawkins speaks outside of his speciality he is a shrill hack. And I would lash him with a noodle if I could.
Don't be stupid.
Comment by kornbelt888 — February 12, 2009 @ 7:03 pm
February 12th, 2009 at 7:06 pm
Provan,
Yes, an example of a pseudoscientific hypothesis.
Falsification is not a suggestion, Don. Since Popper science has adopted it as a logical mandate.
Science has embraced it. Dawkins is avoiding it. And you are following him right off the cliff like a good little monkey.
Comment by chunkdz — February 12, 2009 @ 7:06 pm
February 12th, 2009 at 7:23 pm
kornbelt888,
Just stop talking when you have nothing to say.
Comment by don provan — February 12, 2009 @ 7:23 pm
February 12th, 2009 at 7:32 pm
Raevmo,
And my response is that multiple varieties of dualists were aware of the necessity of the physical when it came to mental operations far in advance of any of these scientific discoveries. One good example: Hylemorphic dualism always regarded eyes as essential to the cause of seeing, and brains for memory (Yes, way back in Aquinas' time it was known that the brain was rather important. Aristotle's as well, though he also suspected the heart was involved.)
It 'narrows the playing field', so long as you're including imaginary competitors to narrow out of them.
Have you not been reading? I gave you multiple examples, and even the link to the Stanford encyclopedia of philosophy for you to bone up on the problems. And I've already asked you recently if you're an eliminative materialist which you saw fit to deny, so there's no way you're not aware of these things on your own unless you're engaged in some serious bluffing.
I've backed them up with references and a short list of those problems. If you want to argue 'the jury is still out', hey – I can play that game as well as you can. And we're back to you hiding in gaps.
We haven't discussed this before – I ask, and you have a tendency to wriggle. But hey, I getcha now – there's no such thing as the objectively wrong. Was the holocaust wrong? Well, that's just a matter of opinion. Wrongness and rightness, those things are illusions. I'll keep it in mind during one of your displays of moral self-righteousness.
Gotta love how much of the clearly obvious one has to give up in order to retain that physicalist commitment, lest unfortunate prospects require being taken seriously.
Comment by nullasalus — February 12, 2009 @ 7:32 pm
February 12th, 2009 at 7:47 pm
DP
Now is your chance to shine
True story
I and a friend of mine were hiking in a dry creek when we found a smooth rock that was more or less hubcap size and shape with an indention in the center. My friend was sure it was a native American grain mill. I was equally sure it was simply a rock. How would archeology prove one of us right and the other wrong. How is this method different from what ID does?
Do you know what the name of this web site is?
Peace
Comment by fifth monarchy man — February 12, 2009 @ 7:47 pm
February 12th, 2009 at 7:59 pm
nullasalus:
Your response nicely illustrates that we seem to have very different concepts of "evidence". When you say that these good old dualists were "aware" of this, way ahead of scientific confirmation, you mean they were just speculating. In very much the same way you are speculating about the immaterial.
I suppose the Hylemorphic dualists were aware of the fact that removing a person's eyes robs them of their sight. Empirical evidence. How they knew that the brain is the seat of memory is less clear to me, likewise with Aristotle's suspicion. Aristotle had many interesting suspicions, such as that pigeons (who nearly always have clutches with two eggs) always produce one son and one daughter. Falsified in the mean time.
Why don't you just spell it out? What's to you the most convincing case of something related to the mind that cannot be done in a physical medium? Then we can trade arguments about that. Could be fun.
I think it was discussed here before. Maybe you forgot. And yes, there's no such thing as the objectively wrong, even the holocaust. Indeed that is a matter of opinion, although in the case of the holocaust nearly everybody has the same opinion. But if you have proof that it was objectively wrong, I'm all ears.
Comment by Raevmo — February 12, 2009 @ 7:59 pm
February 12th, 2009 at 8:36 pm
I'll try to do this later, but please tell me how this will help us? Is there a question whether archeology can be done scientifically? Do we think the established findings of archeology are dubious? How will some amateur that knows nothing about archeology approaching a isolated artifact instruct us about the difference between what archeology does and what ID does? Archeology is the one of the two that has a long history of discovery with many experts we could consult. We could go study archeology in order to become experts ourselves if we wanted to.
ID's the one of the two that hasn't done anything, and doesn't even have a consistent form from "expert" to "expert". I think that's the one we need to consider at work in order to give us information for the comparison. How would ID prove one of you right and one of you wrong?
Comment by don provan — February 12, 2009 @ 8:36 pm
February 12th, 2009 at 9:10 pm
DP
It illustrates that you are simply blowing smoke when you say that archeology and ID are fundamentally different disciplines.
No I only think that ID and archeology and ID study the same thing ie the supernatural.
He will show that until we can determine if an artifact is designed all other questions are moot. This is a similarity between ID and archeology not a difference
So this "science" thing really is just one big appeal to authority? That’s cool I have a higher authority to appeal to
So your saying is there is a difference but you just don’t know what it is?
You’ve got to be kidding. Please list three equivalent situations to mine and just exactly what Archeology consistantly did that was different than ID to infer design.
No fair I asked first.
Peace
Comment by fifth monarchy man — February 12, 2009 @ 9:10 pm
February 12th, 2009 at 10:34 pm
That is incorrect. Determining whether an object is an artifact entails collecting and analyzing all available evidence. That includes determining the relationship of the tool to the tool-maker.
Archaeologists consistently study the causal relationships between the artisan, the art and the artifact. They propose and test hypotheses, including the physical processes of manufacture, then publish for their peers in the scientific community so their results can be crosschecked by multiple disciplines.
Archaeology is defined as the study of (human) artifacts. Artifacts are not supernatural.
You said you were an "advocate". This is your chance to show your mettle.
Comment by Zachriel — February 12, 2009 @ 10:34 pm
February 12th, 2009 at 10:49 pm
Thank you for the correction. So, a statistically significant correlation can be a valid scientific finding. In don provan's example, it would require a more rigorous definition, but he provided sufficient information for a test to be devised. Let's see if we can consider a few other corrections.
We can define a jingle as a particular sound pattern. We can even build test instruments that will recognize the jingle.
I provided a simple example of memetics, but you have ignored it. With verbal memes (which are easily tested with the game of Whispers), we know that familiar topics and short rhythmic motifs are more likely to be transmitted intact. Arbitrary sequences of words quickly dissipate. Long gossipy prose tends to mutate more rapidly with details being compressed and embellishments being added.
I have discussed the problems with memetics. (That jingles are supernatural is not one of those problems.) Memetics proposes that cultural elements have a particulate quality like genes. This is reasonably accurate for some cultural elements, but not all. That limits the usefulness of memetics, and it fails as a unifying theory of cultural evolution.
Perhaps the claim that memetics is a theory of everything cultural is what you mean when you say it's a pseudo-science, but you *say* memetics can't make any predictions, and that is not quite an accurate statement.
Comment by Zachriel — February 12, 2009 @ 10:49 pm
February 12th, 2009 at 11:13 pm
Zach:
Determining whether an object is an artifact is exactly equivalent to inferring design so "collecting and analyzing all available evidence" is how the question is answered.
I have no problem with that. Nor does ID as witnessed by recent posts by Steve Fuller at UD. At the very least it would be the relationship of designer to design.
It might be good to deal with reality instead of a straw man
Explain how you would do this with my example and explain how this process is different than ID.
OK do it with my example. Talk is cheap.
Again I have no problem with this at the very least we can say that the designer caused the design. in the case of my rock/mill I'm not sure how.
Please propose a hypotheses for my friend and I to test.
Fine but you need a hypothesis first, unless this is just another appeal to authority.
lets have your hypothesis for my artifact/rock and please explain how it is different than ID.
Failure to present a hypothesis with a specific distinguishing prediction will be taken as evidence that you are only pretending again and I will not respond. I just don’t have the time for games
They are supernatural. The only part that is natural is the part that is reducible to natural law and matter.
To think we can know about the whole artifact by only studying the natural part a sure way to mistake a millstone for a rock and the category error of scientism. I thought we covered that
peace
Comment by fifth monarchy man — February 12, 2009 @ 11:13 pm
February 13th, 2009 at 12:16 am
Zach,
You misrepresenting me is not the same as me correcting myself.
It can also not be a valid scientific finding. In Provan's experiment, which has a veritable 'alphabet soup' of variables, correlation has no discernable meaning.
As I said, there are many ways to represent abstractions. You are becoming boring and repetitive.
So easily remembered phrases are easy to remember… This is your shining example of the power of memetics? Wow, what a risky prediction!
If Karl Popper were here right now he'd give you and Provan the biggest wedgies you ever had. Provan's pretty big so I'd probably have to help hold him down, but I'd do it – TO DEFEND SCIENCE!
Comment by chunkdz — February 13, 2009 @ 12:16 am
February 13th, 2009 at 9:08 am
The problem is your use of the phrase "all other questions are moot". This typically (and repeatedly on this forum) incorrectly suggests that we don't have to investigate the designer, the designer's characteristics and methodology. Collecting and crosschecking the evidence means each piece of evidence is tested for its fit to the hypothesis. Archaeology does not ignore these facets of the problem, and we expect information about the designer, the designer's characteristics and methodology when investigating any purported artifact.
You must be kidding. ID is an exercise in pretending to be able to detect design without having to say anything about the designer.
Intelligent design begins with a seemingly innocuous question: Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause? — William Dembski
It's a disembodied hypothetical. Not every object can be easily categorized. However, any search for an answer will result in learning about the designer's characteristics and methodology.
You're already proposed two general hypotheses, one natural, one the artifice of Native Americans.
If we suspected a human origin, we would look for other artifacts in the associated strata. We might find hybrid grains in the vicinity of the find, or other tools. This might allow us to determine not only a human origin, but the culture. And such mills may already be identifiable by characteristics common to such mills that have previously been determined by such means. Indeed, the methodology is still practiced among aboriginal Americans, so we can directly examine very similar mechanisms and millstones and study physical effects of the process. A scientific result should be published and crosschecked against other disciplines.
I was hoping the advocate, kornbelt888, would respond to your position.
Yes, I indicated that I flatly reject scientism.
Comment by Zachriel — February 13, 2009 @ 9:08 am
February 13th, 2009 at 9:20 am
Empirical correlations are valid scientific observations.
Your claim is that we can't observe jingles. In fact, we can even detect and categorize jingles with instrumentation.
We didn't define them as easily remembered. We defined them in terms of independent characteristics. More detailed observation will tell us more about how memes are transmitted over time. This answers your inquiry.
Comment by Zachriel — February 13, 2009 @ 9:20 am
February 13th, 2009 at 10:38 am
Raevmo,
If by speculate you mean 'believed to be true based on examination and reasoning', sure.
Wait – are you telling me that, before the scientific method was developed, people 'speculated' that eyes were needed for seeing, tongues for talking, and so on? That this was groundless speculation?
If you want to square of 'empirical evidence' by such lines, you go right ahead. It just serves to back up my point – that the 'empirical evidence' you cite for materialism equally favors a variety of dualisms. Which exposes the entire 'science has proven materialism to be true' routine for what it is – a shell game. An illicit attempt to pretend science is a big materialism-provin' machine, rather than a provider of details that have served to support a variety of views – and that many times the views the results weighed against were physicalist schools of thought.
I already did 'spell it out', complete with a list of specific claims, even a great and apparently neutral-to-physicalist-favoring resource for references of the fundamental arguments. What more do you want?
Along the same lines that I'd have proof of 2+2 = 4. Let me guess – that's a matter of opinion as well, because taking mathematical truths as somehow real would be invoking spooky immaterial abstract concepts.
By all means, stick to the view these things are all subjective. In one masterstroke you flushed the whole New Atheist premise down the toilet, demonstrated just what inanities need to be embraced in the name of materialism, and worse. But hey, you always have an out from saying you don't believe that the holocaust wasn't truly wrong – argue that beliefs don't exist.
Comment by nullasalus — February 13, 2009 @ 10:38 am
February 13th, 2009 at 10:51 am
A proof of 2+2=4 requires an agreed set of axioms. Changing the axioms changes the results. So 2+2=1 (in mod 3 arithmetic).
Comment by Zachriel — February 13, 2009 @ 10:51 am
February 13th, 2009 at 11:03 am
nullasalus:
You mean the 'science has proven materialism to be true' straw man that you apparently need to resort to. I have already indicated above that indeed the empirical evidence is consistent with some varieties of dualism, while refuting other varieties of dualism. The number of dualisms consistent with science is dwindling, but I'm sure there will always be enough for you be content with.
Fine, if you don't want stick out your neck and present your favorite argument in your own words — I understand.
How can one respond to such ignorant nonsense except by slowly and sadly shaking one's head?
Don't worry, I will. Until someone proves me wrong.
Comment by Raevmo — February 13, 2009 @ 11:03 am
February 13th, 2009 at 11:37 am
Zach,
Precisely.
Raevmo,
Strawman? Please. You're wriggling on the point because you see it's untenable to view science that way now. The 'number of dualisms' consistent with science is as numerous as ever. Meanwhile the materialists are being battered by the hard problem on one hand, with intentionality and other questions on the other threatening to reduce them to inanity in order to be consistent.
Run, rabbit, run. I gave you the links, I gave you the specific claims (Do you honestly need me to narrow down 'intentionality' or 'qualia'?). You don't want to engage – suit yourself.
I prefer to highlight the ignorance nonsense I encounter – like finally getting someone to admit that they don't understand how the holocaust could be objectively wrong.
But as usual, you got nothin'.
Gaps are wonderful things.
Comment by nullasalus — February 13, 2009 @ 11:37 am
February 13th, 2009 at 12:22 pm
Hi null,
Actually there was a discussion about this on another thread and if my memory serves me correctly another poster also said the same thing.
Its hard for me to put into words how disgusting this position is to me and how incensed this makes me. I am trying to understand why I get so incensed over this, perhaps I think it is an affront to the 6 million that were stripped of all dignity, put into cattle cars where they had to endure the smell of the shit and pisss of their fellow travelers.
One cannot imagine the degradation and the emotional suffering as husbands were seperated from thier wives. That mothers were seperated from their children never to see them again. Once at the camps rape, murder and torture were standard fair.
Imagine the horror of those marched into the gas chambers at the moment they realized that it was not a delousing they were getting but a lethal gas that would wipe out their lives. Then to the ovens but first to have all the gold removed from their teeh and any other knick knacks the Gremans deemed valuable.
Total human degradation on a scale that boggles the mind yet raevmo and others cannot recognize it for what it was, real objective evil, makes me want to puke. Also pretty scary when you think about it. Imagine a world run by raevmo and his philosophical bedfellows? Not a comforting thought.
Vivid
Comment by Vividbleau — February 13, 2009 @ 12:22 pm
February 13th, 2009 at 12:56 pm
OK, I have a little time for this now. I see you peed your pants in the meantime — I particularly like the part where when I pointed out that there are experts with experience practicing archeology but not ID, you called it "an appeal to authority": a perfect kneejerk — so sorry for delaying a few hours.
OK, so first the archeologist would consider the appearance. From your description, there's nothing about the rock that distinguishes it as of intelligent origin, and, in fact, the archeologist couldn't depend on that, anyway, since the rock may very well have been found in its current form to be used as a mill. So ID strikes out, right off the bat.
Archeology actually says things, unlike ID, so it still has many avenues to proceed down beyond where ID failed. First, the physical appearence might resemble other stones found in locations that make them more obviously tools. Such examples wouldn't be definitive, so we'd need to keep in mind our first point: there may be a reason streams form such stones naturally, and this one is just like the ones that were tools, but wasn't actually found and used as a mill stone.
Second, we can look to see if the stone may have been altered by humans. Once again, the ID "it just looks designed" doesn't apply — you yourself don't think it looks designed — but we do know how humans can shape stones, so archeology would consider evidence of its manufacture. Scoring marks like those made by known tools, for example.
Third is it's location. Humans don't normally put mill stones in creeks, so that suggests against. It would also be unlikely if we don't think humans of that era were growing grain in that area.
Fourth, archeology can consider evidence that the mill was, in fact, used to mill corn (or whatever). There might be a indicitive wear pattern, for example. As I understand it, modern techniques can detect remnants of grain ground into the stone. That would be a really good indicator, if it detected definitively.
Oddly, contrary to your claims, not a single one of the points I've presented involve or depend on any concept of "design", and their only relation to intelligence stems from your hypothesis of human use. Indeed, we see just the opposite of what you've been saying. In archeology, design isn't a first step or even a end conclusion. The end conclusion is human use. Which explains why you, using ID techniques, were left with a yes/no answer based entirely on you looking at the stone, while archeology actually has some real ways to evaluated the evidence that go beyond your personal opinion about whether it was designed.
That's the difference.
Comment by don provan — February 13, 2009 @ 12:56 pm
February 13th, 2009 at 1:05 pm
vivid:
Look how angry and hateful your blind ideology makes you. That's the stuff genocide thrives on. Kill the Christ-killers. BTW, did you have any relatives killed in the holocaust? I did.
Comment by Raevmo — February 13, 2009 @ 1:05 pm
February 13th, 2009 at 1:19 pm
I didn't propose an experiement. You asked for a hypothesis, and I gave you one. Blaming me because the test of my hypothesis could fail to control enough variables is an absurd objection. There very fact that you can identify variables that will obscure my hypothesis supports its validity in the very act of questioning whether it can ever be confirmed or denied in practice.
Since you are now asking for demonstration of power, does this means you're conceding that memes are a meaningful concept, whether useful or not? All this stuff about jingles is just to demonstrate that the concept is meaningful and can be studied scientifically. If you grant that, that's enough for me: I'm not too worried about whether you think it's powerful.
Comment by don provan — February 13, 2009 @ 1:19 pm
February 13th, 2009 at 1:23 pm
Haven't I already?
See this, and this, and this.
Comment by kornbelt888 — February 13, 2009 @ 1:23 pm
February 13th, 2009 at 1:41 pm
Zach,
One of Popper's main tenets was that the less certain that we are about a hypothesis the more powerful it is. The converse is also true. The more certain we are about a hypothesis the less powerful that hypothesis is.
Now let's look at your hypothesis which essentially states that people will more reliably remember "La-de-da" than a long flowing passage from Chaucer.
You've really pissed Karl off this time. I wouldn't wear underwear for the next few days if I were you.
Comment by chunkdz — February 13, 2009 @ 1:41 pm
February 13th, 2009 at 1:48 pm
Provan,
A hypothesis that cannot be reliably falsified is not science.
I asked for a single scientific hypothesis with a falsifiable prediction. Does your failure to produce one mean that you are conceding that memetics is pseudoscience?
If not, prepare for your wedgie.
Comment by chunkdz — February 13, 2009 @ 1:48 pm
February 13th, 2009 at 4:54 pm
You aren't showing that it cannot be falsified, you're just showing that I haven't done enough work to explain exactly how it would be falsified.
I produced one. Your complaints acknowledge that my hypothesis makes a falsifiable prediction by discussing how easily the falsification could be obscured by other variables. The fact that you mistake this as a fundamental objection of Popperian proportions rather than mere procedural difficulties makes me think there's not much point in discussing it any further.
Would it help if we focused on a simpler meme in conditions where we could easily control the variables? Perhaps something about learning how to spell a word? Or will you just complain that no hypothesis about spelling can be falsified because some children are smart and some are dumb?
Comment by don provan — February 13, 2009 @ 4:54 pm
February 13th, 2009 at 5:43 pm
nullasalus:
Yes, a strawman, because I have never claimed that science rules out all of dualism. Go ahead and try to find a counterexample. My claim is – and has always been – that the playing field for dualism gets smaller as more physical explanations are discovered for specific workings of the mind that previously (while the explanations hadn't filled the gaps yet) were claimed by dualists to be outside of the scope of "materialism". Are you saying my claim is incorrect?
Yes, there are things that can't be explained at the moment by materialists. But can they be explained by "immaterialists"? I don't think so. It seems like immaterialists simply define the problems away by defining the immaterial as "that which explains the things materialists can't explain at the moment". In other words, they explain nothing. Or do you have some specific "immaterial" explanation for the "hard problem", or any of the other problems, that goes beyond simply saying "the immaterial dunnit, but we don't what the immaterial really is"? I'm all ears.
It's a cheap shot to bring up the holocaust. Even those who do not believe in objective morals will nearly always agree that the holocaust was wrong (do you think there are those who believe in objective morality who think it was right?) The difficulties for you start when you claim something to be objectively wrong when there is no clear consensus. I challenge you to come up with an example of human behavior that is not so clear-cut but which you claim is nevertheless objectively wrong, and then you show me your proof that such behavior is objectively wrong. I predict that you don't have the balls to do that.
Comment by Raevmo — February 13, 2009 @ 5:43 pm
February 13th, 2009 at 7:17 pm
Raevmo,
I'm saying you're spinning. You rolled in here with the assertion that dualists ignore the evidence provided by science, that science was backing up materialist claims about the mind, etc. Now you're shifting that to 'The playing field is getting smaller' (along with admitting that, in the case of hylomorphists among others, the data's backing up what they've thought about the mind for a long time) because.. what, any physical explanation must be made in place of a presumed dualist explanation? If anything the 'playing field' for dualism is getting larger – materialists are falling back to quasi-dualisms via strong emergence, redefinitions like Searle tries to offer, computationalism, and otherwise. If they aren't diving for 'it will forever be a mystery' or worse.
And in the meantime, you're relying on gaps. And hey, go right ahead and do that. Just be aware of it.
The 'immaterialists' (dualists of various stripes) are doing exactly what the 'materialists' are – engaging in philosophical arguments about what's possible in principle, and how the data is best reflected at this point in particular. Meanwhile the materialist project since the 20th century has been shattered enough that 'material' has practically collapsed into meaning little more than 'anything so long as it has no religious content'. Meanwhile the materialists are divided between pre-emptively calling it all a mystery, embracing absurdity, or – what a surprise – hedging on gaps.
It's not a cheap shot, Raevmo (what should that matter – values are subjective, remember?) – it's merely an easy shot, and it illustrates just what kind of insanity you have to embrace in order to take the philosophical positions you do. Don't like it? Then maybe you should have pulled back on one of the countless expressions of (seemingly objective) moral outrage you've lobbed at religious people in the past – aka, every group you for whatever reason dislike. Turns out all that righteousness was a con-game, an act. But hey, what's to worry – there's no objective value to being consistent and truthful, eh?
Also, I don't have the balls to what – oppose abortion and call it out as objectively wrong? Oppose popular wars while they're still popular? Sorry, I'm more than willing to call out what I consider to be objectively wrong when called upon it. Do I think people will disagree with me? Absolutely. It's not a worry. If the only way the objective is proven or supported is by getting all parties to agree, then 2+2 does not =4. Yes, Zach, I know about base-10 counting systems.
Don't like the feeling that comes with regarding such (objectively) horrible crimes as subjective, aka, no real moral concern? Maybe lend some thought to entertaining the possibility that objective values exist. Running on the fumes of your angry-at-religion rage is only going to get you so far.
Comment by nullasalus — February 13, 2009 @ 7:17 pm
February 13th, 2009 at 7:35 pm
Your ideas are so poorly stated, I'm not even sure what question to ask for clarification. You seemed to indicate that the morality of the holocaust was objective. Morality is not objective. We may share common beliefs, but that doesn't make them objective. Your appeal to mathematics is misplaced. We may or may not share the same axioms.
Your strong subjective response is due to your moral revulsion. Go ahead and puke. That doesn't make it objective.
Comment by Zachriel — February 13, 2009 @ 7:35 pm
February 13th, 2009 at 7:43 pm
Not particularly. I clearly stated the position, you agreed saying you were an "advocate", then I pointed out someone on the thread who held the contrary position.
Perhaps you don't consider fifth monarchy man's comments to be worthy refuting.
Comment by Zachriel — February 13, 2009 @ 7:43 pm
February 13th, 2009 at 7:46 pm
Yes, I provided simple examples when you falsely stated that no valid hypotheses about memes could be proposed or tested. First you handwaved. Now you move the goal posts. More detailed hypotheses can be tested in the same manner which allow us to understand how memes change as they are transmitted from person to person, or from group to group. But that really is irrelevant to refuting your previous position.
Comment by Zachriel — February 13, 2009 @ 7:46 pm
February 13th, 2009 at 8:41 pm
nullasalus:
Your standard tactic is to misrepresent what your opponents said. That alone shows that your position is very weak. Please support your claims next time.
Oh really? Next time offer some arguments instead of mentioning some authorities. That's really all you can do, isn't it, mention some or other philosopher? When are you going to actually engage in an argument?
No they aren't. They just claim that what the "materialists" can't explain at this point must be due to some "immaterial" thing. Dualists can't explain anything. Tell me again how the dualists solve the "hard problem". Don't bother, you can't. Is there anything at all that dualists can explain that can't be explained by materialists? Just give me your best example.
Comment by Raevmo — February 13, 2009 @ 8:41 pm
February 13th, 2009 at 8:48 pm
Zach:
After harping away for several sentences with out giving the required distinguishing prediction you said this
I know but you continue to commit the category error of scientism.
It’s as if I repeatedly said "Jesus is Lord" but when pressed on it said “Of course I’m not a Christian.”
This kind of inconsistency is even more proof you are only pretending.
Let me know when you want to have an honest discussion.
Peace
Comment by fifth monarchy man — February 13, 2009 @ 8:48 pm
February 13th, 2009 at 8:50 pm
nullasalus:
You don't understand. I can feel very strongly about my subjective morals.
Comment by Raevmo — February 13, 2009 @ 8:50 pm
February 13th, 2009 at 8:51 pm
Physicians have long known that a healthy mindset enhances recovery chances in patients. Mind affecting a physical process. How is a material explanation better?
Comment by Bradford — February 13, 2009 @ 8:51 pm
February 13th, 2009 at 8:56 pm
nullasalus:
Again you misrepresent what I said. I predicted you wouldn't have the balls to call something (like abortion) objectively wrong, *and* prove that it's objectively wrong. You didn't prove it. If you can't prove it, then I have to conclude that it's subjective after all.
Comment by Raevmo — February 13, 2009 @ 8:56 pm
February 13th, 2009 at 9:07 pm
Bradford:
It seems that you are assuming that the mind is non-physical. If the mind is physical, it's not surprising that it can affect a physical process.
Comment by Raevmo — February 13, 2009 @ 9:07 pm
February 13th, 2009 at 9:11 pm
I don't have to make any assumptions either way about the physical nature of the mind. It is sufficient to know that attitudes influence physical processes. Attitudes are abstractions. In this case it is the physical speculations about minds which are superfluous to observed outcomes.
Comment by Bradford — February 13, 2009 @ 9:11 pm
February 13th, 2009 at 9:26 pm
DP
Of course your wrong my friend instantly inferred design. Can you prove him wrong scientifically?
Not at all my friend did attempted to do exactly what ID (and archeology) does weigh the evedence.
This exactly what ID does with molecular machines.
Agred, ID (and archeology) are often only dealing in probabilities not certainties that’s what CSI attempts to quantify.
Exactly and my friend disagrees that’s what the question is all about. How do you settle arguments about the origin of artifacts when there are disagreements. Can science be helpful in this regard or is it too weak?
Humans can also modify DNA so this is also an ID approach.
I agree but animal scratches and erosion can mimic scoring marks. Just as it’s argued that evolution can mimic genetic engineering. So far archeology and ID are exactly parallel.
This is the privilege planet thought train.
The design (in this case life) is found where you would most expect a particular kind of designer to put it, ie in an area ideal for discovery
Once again ID and archeology are parallel
Once again ID is parallel we find a molecular structure resembling an outboard motor and lo and behold it is used as a propulsion devise.
I’m not sure what this sentence means our whole endeavor is to decide if we can infer design
It’s a specific kind of use (a designed use). Humans use food but until recently did not design it.
What are you talking about? This question was all about design. My friend and I are both sure that native Americans used the creek bed we were walking in for water in the spring etc
That is obviously true but uninteresting. What we and Archeology and ID are interested in is design
Actually as Ive shown so far archeology and ID are exactly parallel
So there is none
By the way I’ve still seen no distinguishing predictions to determine if I or my friend’s opinions are correct.
Peace
Comment by fifth monarchy man — February 13, 2009 @ 9:26 pm
February 13th, 2009 at 10:05 pm
What, you need me to carry your water for you?
(If FMM reads my prior posts, he'll know what I think.)
Comment by kornbelt888 — February 13, 2009 @ 10:05 pm
February 13th, 2009 at 10:05 pm
Provan,
This is beyond stupid. You say your hypothesis is falsifiable, you just don't feel like explaining how it can be falsified?!?
Now you've gone too far, Provan. You've really pissed Karl Popper off.
Go get 'im Karl!
OUCH!! Now that's what I call the "Wedge Strategy"!!!
Comment by chunkdz — February 13, 2009 @ 10:05 pm
February 13th, 2009 at 10:53 pm
kornbelt888
I do
Apparently unlike Zach I have no problem appreciating nuances
peace
Comment by fifth monarchy man — February 13, 2009 @ 10:53 pm
February 13th, 2009 at 11:42 pm
No, but we can see that after claiming to be an "advocate", you have refused to defend or clarify your position, even after being invited several times.
Odd. Fifth monarchy man did not dispute your statement.
I discussed your hypothetical, explained why the example may not be resolvable, and ventured how an archaeologist might try to understand the origin of the object. I note that you post several sentences about Zachriel, and nothing about the argument.
If we suspected a human origin, we would look for other artifacts in the associated strata (being found in a wadi may make it difficult to find the original site). We might find hybrid grains in the vicinity of the find, or other tools, or other signs of habitation. This might allow us to determine not only a human origin, but the culture. And such mills may already be identifiable by characteristics common to such mills that have previously been determined by such means. Indeed, the methodology is still practiced among aboriginal Americans, so we can directly examine very similar mechanisms and millstones and study physical effects of the process. A scientific result should be published and crosschecked against other disciplines. Notice that the evidence of the characteristics of the crafter and of the craft is mutually supporting of evidence about the crafted object.
Comment by Zachriel — February 13, 2009 @ 11:42 pm
February 14th, 2009 at 12:23 am
You didn't say anything about defending or clarifying. You merely mention my advocacy and wondered why I didn't jump in.
Does my position need additional defense? Is it unclear? Do you need my help? What exactly do you expect?
Comment by kornbelt888 — February 14, 2009 @ 12:23 am
February 14th, 2009 at 1:36 am
Sheesh you act as if I have done something wrong? I plead guilty to the ideology part, my ideology does lead me to the conclusion that the holocaust was evil then , would be evil now, would be evil in the future. In fact my ideology leads me to the conclusion that at no time ever, under no circumstance whatsoever the holocaust was is and would be evil and could not be otherwise.
As for genocide at least I have a compelling argument against it other than, sheesh IMO it is wrong but hey it might be right for soemone else. Gimme a break.
.
What does Christ have to do with this?
All the more why you should be ashamed of yourself.
Vivid
Comment by Vividbleau — February 14, 2009 @ 1:36 am
February 14th, 2009 at 1:43 am
No, what makes it objective is that what took place at the holocaust could never be moral nor anything but evil at any time or any place. What say you?
Vivid
Comment by Vividbleau — February 14, 2009 @ 1:43 am
February 14th, 2009 at 2:28 am
I should add. Regardless of anyones opinion.
Vivid
Comment by Vividbleau — February 14, 2009 @ 2:28 am
February 14th, 2009 at 8:09 am
Vivid, it's not enough to just say that something is objectively wrong. You have to prove it.
Is sodomy objectively wrong? Go ahead, and prove it (with go ahead I mean go ahead with the proof, not the sodomy, not that it's any of my business).
Comment by Raevmo — February 14, 2009 @ 8:09 am
February 14th, 2009 at 8:47 am
Raevmo,
Your standard tactic is to bluff and squirm whenever you're caught retreating. You want me to support it explicitly, rather than referring to what's transpired in this thread? Then by all means.
My complaint is that they reject that for which there is positive evidence in favor of that for which there is no positive evidence. It is classical God-of-the-gaps reasoning without any explanatory power whatsoever.
Which has since squirmed into 'Well, okay, the evidence doesn't work against most of them… but the playing field is tightening', because A) You've since ceded that there are dualist perspectives which, far in advance of the scientific discoveries, were expecting exactly that to unfold, and B) Materialists are engaged in plenty of gap-hiding of their own. And you tried a crooked game where 'positive evidence' could only mean 'material proof' – until you realized that such a standard would push you into materialist camps even you have trouble being in.
The fact that you have to try and suggest that my argument is weak based on imagined technicalities is hilarious. Project much?
Uh, if you're asking me to provide some arguments with regards to what you quoted – that materialism has been taking it on the chin in philosophy of mind for years now – that's included right within the quote. If you think the mysterian position, Searle's strange definition-fights, the associated dives for emergence and non-physicalist epiphenominalism, the pre-emptive intellectual atomic bomb that is eliminative materialism and otherwise don't constitute proof of what I'm saying, and therefore a place to argue, what can I say? At this point you've pretty much given up trying to argue your point here. Now you're just whining.
Hahaha. So this is what you've come down to. So much for 'fine, give me some things materialists have trouble explaining!' – now you've backed onto, 'Err, well.. okay, but tell me how the dualists can explain those things! They're in the same boat!'
The dualists argue amongst themselves too, Raevmo – I've been asserting as much this whole time! They're not a monolithic group. I think the hylemorphist talk of formal and final causality makes great sense both in philosophy of mind and in other fields. Or maybe the property/substance dualists are right and that mental properties really are 'something else', even if they interface deeply with with the modern material. But between the variety of options, the continual breaking-down of the broader material-monist perspective, and otherwise – hey, there's a whole lot of promising ways to go. Meanwhile the only thing that keeps most materialists out of the EM camp is by bluffing, or trying to borrow from the dualists without anyone calling them on it.
That's nice – want a lollipop? Your 'feels strongly' means nothing. You don't – indeed, by what you've taken on philosophically, you can't – think your 'strong feelings' are about anything meaningful. If you 'feel strongly that it was wrong for the holocaust to happen', all that means is that you personally, subjectively disliked it. And your own view is morally equivalent to someone with the opposite perspective. It doesn't mean anything at all. 'The holocaust was a despicable travesty' and 'Man, I like fudge' are equivalent statements for you insofar as their real moral value content. 'I REALLY feel strongly about the holocaust being horrible' is equivalent to 'I *really* like fudge'.
Have fun with that. Hell, have trouble convincing yourself you believe it.
Really Raevmo, you're so damn predictable. When 'your argument is defeated so long as I don't agree with you' is your ace in the hole, you – as usual – got nothin'.
Comment by nullasalus — February 14, 2009 @ 8:47 am
February 14th, 2009 at 8:51 am
Raevmo,
And there's the game. 'You have to prove it, and the standard of proof is that I agree with you. And my position is the default winner if that doesn't happen, because I say so.'
Be honest, Raevmo. Don't you, at least subjectively, find most of what you yourself say about topics like these really rather inane?
Comment by nullasalus — February 14, 2009 @ 8:51 am
February 14th, 2009 at 10:14 am
You haven't answered the objection. Sharing a belief that the Holocaust is evil doesn't make it objective. Your moral revulsion at the Holocaust is understandable. Your misuse of terminology is not.
Comment by Zachriel — February 14, 2009 @ 10:14 am
February 14th, 2009 at 10:24 am
Why would it be understandable if the belief about evil is not objective? If it is truly understandable then the point about objectivity is trivial.
Comment by Bradford — February 14, 2009 @ 10:24 am
February 14th, 2009 at 10:54 am
What did I expect? Or what should I hope for?
advocate, "one that defends or maintains a cause or proposal." From the Latin advocatus, orig. pp. of advocare "to call" (as witness or advisor) from ad- "to" + vocare "call," related to vocem (voice).
Because most people prefer life to death, peace to war. And because centuries of culture have reinforced the communal needs of humans, while better communication allows the notion of tribe to be extended, first to the city then the nation, and now the global community. Meanwhile, some people believe cows are sacred and that killing and eating them is sacrilege.
Comment by Zachriel — February 14, 2009 @ 10:54 am
February 14th, 2009 at 11:44 am
nullasalus:
No, here's the game: you claim that there are objective morals (which happen to coincide with your morals I suspect), but you don't offer evidence for this claim. I infer that your claim is therefore just an opinion, and therefore subjective. And therefore your morals are subjective. Do you understand, or do I have to explain it again?
Comment by Raevmo — February 14, 2009 @ 11:44 am
February 14th, 2009 at 12:36 pm
And there is the rub as they say. What constitutes proof and what do you define as objective?
One need only to demonstrate that one thing is objectively wrong to demonstrate that there is such a thing as an objective moral so lets stick with the holocaust.
Well if a certain action cannot not be anything but evil at all times given the same circumstances irrespective of anyones opinion to the contrary that is as objective as it gets. Thats why I asked the question of you that I did in my previous post which so far you have not answered.
What say you Zach? Is it possible for the holocaust to not be an evil act at all times given the same circumstances irrespective of anyones opinion?
Vivid
Comment by Vividbleau — February 14, 2009 @ 12:36 pm
February 14th, 2009 at 12:54 pm
No, that's not what we mean by objective. Just because everybody everywhere thinks a flower is pretty, doesn't mean that pretty is an objective characteristic. Even if you say that the flower cannot not be anything but pretty at all times given the same circumstances irrespective of anyones opinion to the contrary, doesn't make it an objective determination. That's just not what the word means.
objective: of, relating to, or being an object, phenomenon, or condition in the realm of sensible experience independent of individual thought and perceptible by all observers.
Comment by Zachriel — February 14, 2009 @ 12:54 pm
February 14th, 2009 at 1:18 pm
This would make non intelligent evolution non objective since it is not percieved by all observers. According to this definition the earth is not objectively a sphere because some group think the earth is flat. It is not objective that we went to the moon because there are some who think it a hoax etc, etc.
Vivid
Comment by Vividbleau — February 14, 2009 @ 1:18 pm
February 14th, 2009 at 3:29 pm
There is nothing in the definition about majorities or consensus. Rather, an objective observation is one that can be verified by independent observers. It's a dictionary definition so it's not meant to be comprehensive, and it assumes some knowledge of the terms being used.
Comment by Zachriel — February 14, 2009 @ 3:29 pm
February 14th, 2009 at 8:01 pm
I stated:
nullasalus has done nothing to refute my statement, but squirms:
You admitted yourself that no amount of evidence can dispel dualism. That's because it's an entirely vacuous enterprise without any distinguishing predictions.
Ad A) You must be joking. I guess you are referring again to ancient dualists who opined that eyes are needed for seeing and the brain for thinking "far in advance of the scientific discoveries". Maybe you think some higher power must have whispered it into their ears, but in fact their opinion has almost certainly nothing to do with their dualist views. Rather, their opinion much more likely derives from observations that people without eyes cannot see and people with damaged heads cannot think clearly.
Ad B) You are just making that up. I asked you for any kind of positive proof but you failed to provide. All you offered were some philosophers who have ideas that you like. There are other philosophers who disagree. So where's the proof? It just demonstrates that philosophy is not very helpful in discovering the nature of the mind.
So you admit that you can't explain those things. Thanks for confirming that.
Of course they do. That's all they do. That's what they must do because they cannot contribute any facts that might shed some light on the nature of the mind.
Oh I see. In contrast, your opinion – which you seem to feel very strongly about – that your imaginary friend laid down the moral laws is very meaningful. The difference seems to be that I have to do my own thinking, while you rely on old books written by people who did the thinking for you. I see now that your perspective is far superior.
So you are saying that 2+2=4 is equivalent in objectiveness to saying "abortion is wrong", or "gay sex is wrong", or "adulterers should be stoned". I have to admit, it's an interesting point of view. Interesting from a clinical point of view.
You're funny in a tragic kind of way. What's this "you got nothin'" all about? Do you fashion yourself Al Capone in The Untouchables?
Comment by Raevmo — February 14, 2009 @ 8:01 pm
February 14th, 2009 at 8:45 pm
The point is that someone might very well reject the axioms of standard arithmetic, and might do so for perfectly valid reasons. When they do, the theorems differ from what you might be used to. But they are equally valid.
Similarly, ethics are built on axioms. These axioms are shared beliefs. They might vary from group to group; women may or may not be equals, slavery may or may not be allowed, killing might be allowed for this but not that. But because we're talking about people, they typically share many of the same concerns and problems of living in civil society, so they often share many of the same precepts. Many of these precepts concern the value of things, e.g. the value of people compared to property. From agreed precepts, people can reason together and devise codes of conduct. E.g. wasteful killing is wrong, so when is it appropriate to kill?
But like different axioms in arithmetic, if we change our moral axioms, we will derive a different moral code. So in some societies, it's mandated that you stone adulterers. In others, it's okay to kill dangerous foreign conspirators in your midst. In an intelligent insect society, eating your mate might be considered de rigeur.
Comment by Zachriel — February 14, 2009 @ 8:45 pm
February 14th, 2009 at 10:24 pm
No I did not think you would like the definition you gave me once I pointed out the implications of what you gave that defined what was objective. On second thought you are now going back to punt which I knew you would
Of course there was nothing in the definition about majorities or consensus the definition stated just the opposite "perceptible by all observers"
So now I guess we have a new version, an objective observation is one that can be verified by independent observers. Ok , independent observers do not buy into non telic evolution. Independent observeres assert that the world is flat and that we never went to the moon.
Then you only have yourself to blame for the ambiguity, no one forced you to give it. Now you are, as I said, punting.
Vivid
Comment by Vividbleau — February 14, 2009 @ 10:24 pm
February 14th, 2009 at 11:25 pm
It also says in the "realm of sensible experience independent of individual thought."
And now you are conflating an objective observation with a scientific theory.
Comment by Zachriel — February 14, 2009 @ 11:25 pm
February 15th, 2009 at 12:07 am
What other kind of experience is there? Even thought is an experience. The only thing we can experience comes through the senses.
But telic evolutionists are making observations.
Vivid
Comment by Vividbleau — February 15, 2009 @ 12:07 am
February 15th, 2009 at 12:29 am
Thought is not a sensible experience, meaning the primary senses of sight, sound, smell, taste and touch. Even though we may agree a flower is pretty, the experience of prettiness is not a primary sense, but a subjective valuation. Even though we might agree that life is better than death, that is also just a subjective valuation.
The actual scientific output of "telic evolutionists" is virtually nil. But that is irrelevant to your conflation of theory and observation. We observe the Sun and stars move in the sky. Heliocentrism is a theory that explains those observations. As with all theories, it is judged on its fit to the data and its ability to make observational predictions. Returning to your original statement.
We were discussing objectivity. Independent observers agree that the Earth appears flat from a position near the surface. The curvature of the Earth (before circumnavigation) was inferred from a variety of evidence. Some might agree, others might disagree with that inference, depending on the quality of that evidence; but independent observers would still agree that the Earth appears flat from a position near the surface.
Comment by Zachriel — February 15, 2009 @ 12:29 am
February 15th, 2009 at 12:51 am
Another qualifier I see. However when I think I sense myself, this is as real as any of the "primary senses" you speak of.
But I a not conflating the two. You are the one that stated that to be objective something must be subject to independent observation. The earth is something, indpendent observers observe it as flat. Evolution is something and independent observers observe it to be telic. I am just following your lead Zach. Although I must say those goal posts sure are moving around a bit.
Im not so sure that all independent observers agree that the earth is round. I think I read somewhere that there is an organization called the flat earth society. If there is and if they are serious then not all independent observers agree.
Actually I would make the case that the flat earthers are independent observers since they are going against the grain of the vast majority of round earthers. In fact the round earthers are not independent at all since they are going along with practically everybody else.
Vivid
Comment by Vividbleau — February 15, 2009 @ 12:51 am
February 15th, 2009 at 10:16 am
The same qualifier as originally provided. That's what we mean by "sensible experience" in this context. No one says your other senses are not valid. They're just not objective.
That is considered subjective. That's because only you can experience your sense of yourself.
Not quite. They perceive local areas as flat, and only if they are near the surface. They also perceive that sails appear before hulls on approaching ships. They also observe the movement of the planets across the sky, and with a telescope, the moons of Jupiter.
We can directly observe evolution including non-telic mechanisms such as mutation and selection. Common Descent can't be directly observed, but is inferred from the observed nested hierarchy.
Before circumnavigation, no one could observe that the Earth was round. Rather, it was inferred from a variety of evidence, including astronomical.
You're still conflating theory and observation. Flat-Earthers observe, if they bother to observe at all, the same things everyone else does, but draw a different (and scientifically unsupportable) conclusion.
Flat Earth Society
-
Comment by Zachriel — February 15, 2009 @ 10:16 am
February 15th, 2009 at 3:20 pm
And you can experience my pain?
No you only directly observe change. You only directly observe mutation and selection.
Vivid
Comment by Vividbleau — February 15, 2009 @ 3:20 pm
February 15th, 2009 at 4:57 pm
One can empathize with another, but that, like your pain, is subjective.
Yes, we observe change in populations. That's called evolution. We can't directly observe ancient transitions. Historical reconstruction requires making and testing hypotheses.
Comment by Zachriel — February 15, 2009 @ 4:57 pm