« James Watson claims Africans are less intelligent than Westerners
Put a Spandrel in the Works »

A critique on the endosymbiotic theory for the origin of mitochondria

by MikeGene

The following essay was written by Albert de Roos and the views/arguments contained within do not necessarily reflect the views of Mike Gene. Mike Gene hosts such essays simply to provoke thought and promote discussion and communication.

The endosymbiotic theory for the origin of mitochondria claims that our mitochondria were derived from an engulfed bacterium that was enslaved to become the current powerhouse of most eukaryotic cells. This endosymbiotic theory has become consensus among evolutionary biologists to such an extent that it is considered a fact and forms the basis for most research on molecular evolution. In fact, a falsification of the endosymbiotic theory would shake the scientific world and would have to lead to the reinterpretation of virtually all phylogenetic data. I argue that the mechanistic basis of the endosymbiotic theory is not sound and even contradictive to our current concepts of evolution. Therefore, there seems to be no reason to consider the endosymbiotic theory a fact.

All evolutionary theories must offer an explanation in mechanistic terms of how it should or could have happened in order to be tested. The difficult thing with the endosymbiotic theory is that it proposes no real mechanism and most textbooks show the simplistic picture of a cell that swallows another cell that becomes a mitochondrion. Unfortunately, it is not so simple as that. There is a difference between the process of endosymbiosis and its incorporation in the germline, necessitating genetic changes. What were those changes? What was the host? Was it a fusion, was it engulfment, how did the mitochondrion get its second membrane, how did two genomes in one cell integrate and coordinate? The theory is also strongly teleological, illustrated by the widely used term "˜enslavement'. But how do you enslave another cell, how do you replace its proteins and genes without affecting existing functions? The existence of obligate bacterial endosymbionts in some present eukaryotes is often presented as a substitute for a mechanism, but they remain bacteria and give not rise to new organelles. So, before we can speak of the endosymbiotic as a testable scientific theory, we need a mechanistic scenario which is lacking at the moment.

When we do try to envision a mechanistic scenario based on the endosymbiotic theory, we quickly run into problems. Genetic mutations that allow bacteria to thrive in the cytoplasm would not be strategic for survival. Anaerobic cells normally do not survive in environment that contains oxygen, while the endosymbiont would need oxygen in order to present fitness advantage. The two organisms would initially compete for energy sources since bacteria are users of ATP and do not export it. The extensive gene transfer that is needed in the endosymbiotic theory would wreak havoc in a complex genome since frequent insertion of random pieces of mitochondrial DNA would disrupt existing functions. Furthermore, gene transfer is a multi-step process were genes need to be moved to the nucleus, the different genetic code of mitochondria needs to be circumvented, the genes need to be expressed correctly, as well as imported back into the mitochondria in order to be functional. All in all, mechanistic scenarios for the endosymbiotic theory imply many non-functional intermediates or would just be plain harmful to an organism. Therefore, the endosymbiotic theory is in contrast with the concept of gradualism that forms the basis of modern evolutionary theory.

Let's have a look at the evidence that is presented in favor of the endosymbiotic theory. An important part of the evidence consists of similarities between bacteria and mitochondria, although is quite evident that the differences are enormous. Most pictures in textbooks of mitochondria resemble bacteria, but in reality, mitochondria form a dynamic network of interconnecting tubules (reticulum). The bacteria-like EM images of mitochondria that we know from textbooks are really cross-sections of tubules and a closer look reveals connections between the endomembrane system and mitochondria. Moreover, its organization is tightly linked to the cell cycle and is currently under complete eukaryotic control with most genes residing in the nucleus. In some textbooks the Lamarckian acquisition of a double membrane of mitochondria is even presented as evidence for engulfment. It is said that mitochondria, like bacteria, divide by fission, but the mechanisms are completely different and mitochondria use mainly components of unique eukaryotic origin. The use of circular DNA in mitochondria has been taken as evidence, but there are also many organisms that have linear mitochondrial chromosomes with eukaryotic telomeres. So, although we see some characteristics that are shared between mitochondria and bacteria, we see many more examples where mitochondria are actually quite different.

It is also claimed that phylogenetic evidence firmly supports the endosymbiotic theory, for instance by showing relatedness between mitochondria and specific groups of bacteria. Some mitochondrial proteins show indeed a similarity with specific bacterial proteins, both at the structural and at the gene level. However, this does not show that mitochondria are derived from bacteria, but only that these proteins have a common descent. Next to an origin from bacteria, it can also be that these related proteins descended from a common ancestor, that only the genes were transferred or that bacteria picked up the genes from either the nucleus or the mitochondria. In general, large mitochondrial genomes contain a mix of presumed eukaryotic, archaeal and eubacterial genes, in contrast to what you expect if mitochondria are of eubacterial origin. Furthermore, a priori assumptions in phylogenetic analyses, such as long-branch attraction can bias phylogenetic tree analysis. This is illustrated by the amitochondriate organisms that can be either placed ancestral in the eukaryotic tree or derived, depending on whether you assume they once possessed mitochondria or not. Thus, as long as we do not have a clear picture of the last common ancestor and its relationship with eukaryotes, it will be difficult to interpret gene similarity as evidence for the endosymbiotic theory.

There are alternative explanations for the origin of mitochondria that can compete with the endosymbiotic theory and that are in line with the phylogenetic data. In an autogenic origin, mitochondria are evolutionary derived from the eukaryotic endomembrane system. Its evolution can be driven by the advantages to sequester metabolic activity in specialized compartments. As extensions to existing functionality, the targeting and import mechanisms could be developed gradually and based on existing eukaryotic functions, for instance already existing ER or organelle targeting. The acquisition of DNA would enable the metabolic vesicles to become relatively independent by expressing proteins that cannot be imported through normal organelle targeting or that facilitate mitochondrial functions. The mitochondrial genes could be derived from transposable elements, plastids or viruses and could come from either the nuclear genome or a bacterial genome. The components of the essential ATP-generating cascades suggest a gradual evolution based on expanding on an existing proton motive force coupled to ATP generation. Intermediates exist in the form of hydrogenosomes and mitosomes from amitochondriate primitive eukaryotes. Thus, we do have an alternative hypothesis that defines a gradual mechanism that includes intermediates fitness advantages for these steps, in line with Darwinian theory.

In order for an evolutionary theory to be considered a scientific fact or a valid scientific theory, there are some basic requirements. First, it is necessary to have a reasonably detailed mechanism that explains the basic steps in the endosymbiotic scenario. Second, this mechanism should be placed in the context of current Darwinian evolutionary theory and should contain no fundamental problems or falsifications. Third, a substantial body of empirical evidence that directly supports this scenario should be present. Fourth, no credible or logically sound alternatives should exist. If these criteria are not met, the endosymbiotic theory cannot be considered to be a scientific fact that has been proven beyond reasonable doubt. Remarkably, the endosymbiotic theory fails all points.

[I have started a website where I will publish my research on alternative theories for the origin of mitochondria. References to my claims above can also be found there. See for instance images of mitochondria and of bacterial endosymbionts , the claims of the endosymbiotic theory as a fact and the overly simplistic mechanisms.]

This entry was posted on Wednesday, October 17th, 2007 at 7:08 am and is filed under Guest Post. You can follow any responses to this entry through the RSS 2.0 feed. You can leave a response, or trackback from your own site. The trackback link is: http://telicthoughts.com/a-critique-on-the-endosymbiotic-theory-for-the-origin-of-mitochondria/trackback/

43 Responses to “A critique on the endosymbiotic theory for the origin of mitochondria”

  1. Tom Mundie Says:
    October 17th, 2007 at 8:50 am

    It actually gets much more complicated that just the endosymbiotic process. Check out publications by Dr. T. Cavalier-Smith over the last 10 years. He says, "The origin of the eukaryotic cell was the most complex transformation and elaborate example of quantum evolution in the history of life." Since eukaryotic subcellular systems depend on each other he argues that the following 10 major suites of innovation had to occur at the same time:
    1. Endomembrane system (including budding and fusion)
    2. Cytoskeleton (including molecular motors)
    3. Nucleus (including the pore complex and RNA transport)
    4. Linear chromosomes (including pleural origins, centromeres, telomeres
    5. Cell cycle controls and mitotic segregation
    6. Sex (including meiosis)
    7. Origin of peroxisomes
    8. rRNA processing
    9. Origin of mitochondria (including import mechanisms)
    10.Spliceosomal introns

  2. Comment by Tom Mundie — October 17, 2007 @ 8:50 am

  3. nullasalus Says:
    October 17th, 2007 at 9:41 am

    Interesting post. The links seem busted, however.

  4. Comment by nullasalus — October 17, 2007 @ 9:41 am

  5. Bradford Says:
    October 17th, 2007 at 10:37 am

    In order for an evolutionary theory to be considered a scientific fact or a valid scientific theory, there are some basic requirements. First, it is necessary to have a reasonably detailed mechanism that explains the basic steps in the endosymbiotic scenario.

    My objection to the endosymbiotic theory is similar to my objection to abiogenesis. It lacks causal specificity where it counts- the details. There is a related similarity namely, how is the endosymbiotic theory falsified? Underlying that question is the dilemna faced when attempting to falsify anything that lacks a step by step causal scenario. If event x did not occur as theorized it might never be possible to falsify the theory. It's like trying to eat soup with a fork. The vagueness of a theory can protect it from falsification.

  6. Comment by Bradford — October 17, 2007 @ 10:37 am

  7. Bradford Says:
    October 17th, 2007 at 10:38 am

    One more thing. Nullasalus is right about the busted links.

  8. Comment by Bradford — October 17, 2007 @ 10:38 am

  9. AdR Says:
    October 17th, 2007 at 12:31 pm

    Bradford, I think the concept of irreducible complexity represents a bona fide falsification of evolutionary theories. Irreducible complexity is not compatible with gradualistic darwinian theory, and when found, it means that the theory is wrong. It is the same as a perpetuous motion machine for physics.

    Normally, scientists should recognize IC, and come up with a different, mechanistic theory. But in the case of IC and intelligent design, instead of changing their theories they started defending them. Imagine a physicist defending perpetuous motion machine, it just plain ridiculous. I see scientists defending evolutionary theories by claiming that irreducible complexity is possible, which is also ridiculous for anyone that understands the concept of gradualism.

    I see IC with almost every evolutionary theory about molecular evolution and this is because the theoretical mechanistic changes for the scenarios to be made, you would need either foresight or intermediates with drastically reduced fitness (the so-called hopeful monsters). Both possibilities do not fit in our current Darwinian framework. So it is not that you can not find a sequence of events that would lead from a bacterial endosymbiont to a reticular mitochondrion, no you cannot find such a scenario that makes sense in terms of survival.

    What you see now, is that instead of changes the proposed scenarios, they try the change the scientific framework. Koonin just proposed big bang scenarios in which things just spring into existence, they invented things like the neutral theory of evolution where functionalities just drift into existence, they came up with lateral gene transfer where genes are randomly reorganized to built complete multicomponent functional systems.

  10. Comment by AdR — October 17, 2007 @ 12:31 pm

  11. Bradford Says:
    October 17th, 2007 at 1:19 pm

    AdR:

    Normally, scientists should recognize IC, and come up with a different, mechanistic theory. But in the case of IC and intelligent design, instead of changing their theories they started defending them. Imagine a physicist defending perpetuous motion machine, it just plain ridiculous. I see scientists defending evolutionary theories by claiming that irreducible complexity is possible, which is also ridiculous for anyone that understands the concept of gradualism.

    I have often pointed out in exchanges that cooption is a conceptual solution to a physical problem and not one that can be tested as long ages are a test condition. It seems that problems with gradualism suggest tests that could advance IC although, there is a clear bias against the idea.

    I see IC with almost every evolutionary theory about molecular evolution and this is because the theoretical mechanistic changes for the scenarios to be made, you would need either foresight or intermediates with drastically reduced fitness (the so-called hopeful monsters). Both possibilities do not fit in our current Darwinian framework. So it is not that you can not find a sequence of events that would lead from a bacterial endosymbiont to a reticular mitochondrion, no you cannot find such a scenario that makes sense in terms of survival.

    Theorized changes in the genome of the consumed organism are antithetical to selection. The enslavement term is an apt descriptor. Its problem is the absence of a mechanism to go with the concept.

  12. Comment by Bradford — October 17, 2007 @ 1:19 pm

  13. JOHN_A_DESIGNER Says:
    October 17th, 2007 at 3:46 pm

    In order for an evolutionary theory to be considered a scientific fact or a valid scientific theory, there are some basic requirements. First, it is necessary to have a reasonably detailed mechanism that explains the basic steps in the endosymbiotic scenario. Second, this mechanism should be placed in the context of current Darwinian evolutionary theory and should contain no fundamental problems or falsifications. Third, a substantial body of empirical evidence that directly supports this scenario should be present. Fourth, no credible or logically sound alternatives should exist. If these criteria are not met, the endosymbiotic theory cannot be considered to be a scientific fact that has been proven beyond reasonable doubt. Remarkably, the endosymbiotic theory fails all points.

    As a real life designer I've long been puzzled by the lack "a reasonably detailed mechanism" that can explain any the problems that still confront global versions naturalistic evolutionary theory (NET). My job involves designing heavy earth moving equipment that is used in the construction and mining industries. How did I get into this line of work? I have always been curious how things are designed and made. Naturally this curiousity has also translated into a lifelong interest in science.

    As a real life designer I have to not only understand in detail what a particular machine is supposed to do but I have to understand in a very real evolutionary step by step manner how this thing needs to made. What baffles me about the every-living-thing is caused by unintelligent-unguided-natural-forces people is that they can never give me a detailed step by step explanation of how that supposedly happens. For example, how did non-living chemicals give rise to self replicating organisms? Or, how did protozoa give rise to metazoa? Why is it that nobody, including some of the worlds leading scientists, can give me a rigorous and detailed step-by-step explanation backed by sound experimental and empirical evidence. Why is the only type of explanation that I have ever read are "just-so stories" with a lot "˜if-thens' and "˜coulds'? Am I missing something or I am supposed to accept their arguments on faith?

  14. Comment by JOHN_A_DESIGNER — October 17, 2007 @ 3:46 pm

  15. AdR Says:
    October 17th, 2007 at 5:42 pm

    JOHN, I think the reason might be that evolutionary scientists that determine consensus are not engineers, but chemists. They don't see evolution as a system, but as a cascade of biochemical processes and fail to recognize the functional modules. As the interface is often represented by a chemical signal, they study the signal instead of its effector.

    My own research on molecular research started after I quickly dismissed the consensus story (in this case introns-late) that as well lacked a mechanism. I instead tried to think of mechanisms that would produce gradual scenarios. It beats me as well why scientists seem to be satisfied with the just-so stories. Maybe their funding is dependent on it.

    As you indicate, we have to look at the components and see how it works as a system. I tried to do that in my articles. I found that the way you put in together in evolution, looks a lot like how it is assembled in development.

  16. Comment by AdR — October 17, 2007 @ 5:42 pm

  17. Eric Anderson Says:
    October 17th, 2007 at 9:30 pm

    I don't know enough about this particular topic to take a position, but I am happy to see another side being discussed, as the theory seems wildly fantastic, even at first blush. Another just so story? Absent, of course, some prior planning/guidance! :wink:

  18. Comment by Eric Anderson — October 17, 2007 @ 9:30 pm

  19. MikeGene Says:
    October 17th, 2007 at 10:41 pm

    Links fixed

  20. Comment by MikeGene — October 17, 2007 @ 10:41 pm

  21. Exile From Groggs Says:
    October 18th, 2007 at 4:49 am

    The Biological Big Bang paper would suggest, I think, that the inclusion of bacteria in cells to form mitochondria would have occurred at an early stage, when for example membranes were substantially less defined than they are now.

    OTOH, whilst conceptually this deals with some of the issues, it is again not much more than a just-so story at this stage.

  22. Comment by Exile From Groggs — October 18, 2007 @ 4:49 am

  23. Doug Says:
    October 18th, 2007 at 2:05 pm

    Great post!
    I put it right up there with TP's 'Ethics of ID'. Very happy that TT is doing these host posts.

    I don't see it brought up much, so maybe there's really no issue. But what about the host cells response to this invader (or engulfed foreign object)? Wouldn't there be a host of enzymes that would be right on this?
    Even if this were at a point where enzymatic response would be inhibited (for whatever reason)…. would this host cell get inundated with foreign objects?

  24. Comment by Doug — October 18, 2007 @ 2:05 pm

  25. geoffrobinson Says:
    October 18th, 2007 at 2:23 pm

    I don't think this is simply a just-so story. It is a pretty interesting theory. The problem (and problems outside of this) is the philosophy covering over the IC problems. Any IC structure can't be so because of the assumed truth of the philosophy.

    In other words, we are working within an unfalsifiable paradigm. And as such, sub-theories about mitochondria can suffer from the same problem.

  26. Comment by geoffrobinson — October 18, 2007 @ 2:23 pm

  27. Bradford Says:
    October 18th, 2007 at 2:37 pm

    geoffrobinson:

    I don't think this is simply a just-so story. It is a pretty interesting theory. The problem (and problems outside of this) is the philosophy covering over the IC problems. Any IC structure can't be so because of the assumed truth of the philosophy.

    Agreed. If IC is defined as the necessity of all parts for function then its validity is testable for any particular system x. Confirming that does nothing to evaluate a separate issue, namely, whether x could have evolved through RM+ NS. So far philosophy is not an obstacle to assessing IC and the related question of evolvability.

  28. Comment by Bradford — October 18, 2007 @ 2:37 pm

  29. Raevmo Says:
    October 18th, 2007 at 2:38 pm

    De Roos:

    When we do try to envision a mechanistic scenario based on the endosymbiotic theory, we quickly run into problems.

    I think you're overdoing it a bit, probably and understandably in your desire to hawk your own theory (potentially eternal fame and glory!)

    Anaerobic cells normally do not survive in environment that contains oxygen, while the endosymbiont would need oxygen in order to present fitness advantage.

    No problem. The original "slave" might have been photosynthetic, while the "host" might have been a facultative aerobe thanks to peroxisomes.

    The two organisms would initially compete for energy sources since bacteria are users of ATP and do not export it.

    No problem when the slave was photosynthetic.

    The extensive gene transfer that is needed in the endosymbiotic theory would wreak havoc in a complex genome since frequent insertion of random pieces of mitochondrial DNA would disrupt existing functions.

    No problem. This could easily have happened gradually over a long time. Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    (sources: Cavalier-Smith 2006, Proc. R. Soc. B 273, 1943-1952; de Duve 2007, Nature Reviews Genetics 8, 395-403)

  30. Comment by Raevmo — October 18, 2007 @ 2:38 pm

  31. Bradford Says:
    October 18th, 2007 at 3:03 pm

    When we do try to envision a mechanistic scenario based on the endosymbiotic theory, we quickly run into problems.

    Raevmo: I think you're overdoing it a bit, probably and understandably in your desire to hawk your own theory (potentially eternal fame and glory!)

    I think you're recklessly imputing motives to satisfy your preconceptions about those with ID outlooks.

    The extensive gene transfer that is needed in the endosymbiotic theory would wreak havoc in a complex genome since frequent insertion of random pieces of mitochondrial DNA would disrupt existing functions.

    Raevmo: No problem. This could easily have happened gradually over a long time. Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    No problem? Is that a substitute for a mechanism? How would a random dismemberment of a genome not wreck hovoc on it or is this some non-random process linked to specified nucleotide sequences?

  32. Comment by Bradford — October 18, 2007 @ 3:03 pm

  33. Raevmo Says:
    October 18th, 2007 at 3:22 pm

    Bradford:

    I think you're recklessly imputing motives to satisfy your preconceptions about those with ID outlooks.

    Ah, is that what you think? Thanks for surprising me.

    No problem? Is that a substitute for a mechanism? How would a random dismemberment of a genome not wreck hovoc on it

    Random dismemberment? Is that a substitute for a mechanism? A slow process of gene transfer doesn't wreak havoc. After all, our own genome is littered with insertions of ancient transposons and virusses (you know, junk DNA), and we're still here, aren't we?

  34. Comment by Raevmo — October 18, 2007 @ 3:22 pm

  35. Doug Says:
    October 18th, 2007 at 3:32 pm

    I think you're overdoing it a bit, probably and understandably in your desire to hawk your own theory (potentially eternal fame and glory!)

    Is this how you address his points? Could it be that he saw a flaw, thought of a more reasonable answer, and then advanced it? Anyway, nice open-minded response.

    No problem. The original "slave" might have been photosynthetic, while the "host" might have been a facultative aerobe thanks to peroxisomes.

    Of course there's no problem when you've got a handful of 'mights' to throw around. Are you being sincere with this? Or are you just hawking your own objection?

    No problem. This could easily have happened gradually over a long time. Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    Wow, not only 'mights' but you've got 'coulds' to structure your unwillingness to even consider his objection. How much time are you allotting this bacteria to get settled? What is the life span of this individual host cell that enveloped the pre-mitochondria… for this smooth and gradual (non-distruptive) transfer of mitochondrial DNA? If it did happen that way then the whole set-up seems to scream intention.

    ** further**

    Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    How does this address AdR's point? It's exactly this transfer of DNA that would potential wreak the aforementioned havoc on the hosts DNA.

  36. Comment by Doug — October 18, 2007 @ 3:32 pm

  37. Bradford Says:
    October 18th, 2007 at 3:44 pm

    Random dismemberment? Is that a substitute for a mechanism? A slow process of gene transfer doesn't wreak havoc. After all, our own genome is littered with insertions of ancient transposons and virusses (you know, junk DNA), and we're still here, aren't we?

    What an analogy. The genome of a unicellular organism is considerably larger and more complex than a viral genome. How does this process work? Are genes neatly excised and if so why would this occur? What would account for the subsequent transport and insertion process? Did the capacity for it preexist the consumption event or did it evolve. Why did it evolve? What are the steps in general outline?

  38. Comment by Bradford — October 18, 2007 @ 3:44 pm

  39. Raevmo Says:
    October 18th, 2007 at 3:49 pm

    Doug:

    Is this how you address his points? Could it be that he saw a flaw, thought of a more reasonable answer, and then advanced it? Anyway, nice open-minded response.

    Lighten up, Doug. I appreciate Albert's contribution. At least no politics (well, less than usual) for a change.

    Of course there's no problem when you've got a handful of 'mights' to throw around. Are you being sincere with this? Or are you just hawking your own objection?

    Read the papers I cited. There's lot's of mights to throw around but some mights are more informed than others. I'm saying there are reasonable objections to Albert's problems with the endosymbiont theory for the origin of mitochondria. I wonder if he also has the same problems with the origin of chloroplasts.
    Besides, it would be boring if everybody agreed with Albert's post, wouldn't it?

  40. Comment by Raevmo — October 18, 2007 @ 3:49 pm

  41. Raevmo Says:
    October 18th, 2007 at 3:52 pm

    Bradford:

    How does this process work? Are genes neatly excised and if so why would this occur? What would account for the subsequent transport and insertion process? Did the capacity for it preexist the consumption event or did it evolve. Why did it evolve? What are the steps in general outline?

    Do some research on horizontal gene transfer. I'm off to the pub now. See you later.

  42. Comment by Raevmo — October 18, 2007 @ 3:52 pm

  43. Bradford Says:
    October 18th, 2007 at 4:08 pm

    Raevmo:

    Do some research on horizontal gene transfer. I'm off to the pub now. See you later.

    Another inadaquate analogy. You're long on claims and short on specifics. But that is the nature of endosymbiotic claims.

  44. Comment by Bradford — October 18, 2007 @ 4:08 pm

  45. AdR Says:
    October 18th, 2007 at 4:14 pm

    Raevmo, I don't see what scenario you are referring to. The apparent fitness advantage for the host is supposed to be aerobic respiration, so I assume that oxygen is needed in order to be functional. If we have an facultative aerobe, it already had aerobic respiration. Maybe you mean facultative anaerobic in the sense that the host had peroxisomes in order to prevent itself to the harmful effects of reactive oxygen species.

    It's funny that you mention peroxisomes, as people once thought they were endosymbionts but now evidence seems to point to en origin from the ER. I like to point out that the peroxisome possesses many of the charcteristics of mitochondria, including protein targeting and division.

    Do you you of any bacteria that initially export ATP? What was the advantage from the hosts point of view? What advantages had the endosymbiont? Do you think there were mechanisms to specifically transfer DNA (I am sure IDists would like such a scenario), or was it just random. We know from cancer research that it is generally not a good idea to randomly insert DNA, so the means to transfer would likely harm the cell.

    Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    So, you first have genetic conflict (whatever that may mean, but it must not be good for the cell) and then the cell starts to transfer DNA. Wouldn't it be a little too late for that?

    That's another kind of reasoning that I see among evolutionists: the invention of a new function in response to another deleterious step. Like you develop telomerase because otherwise your DNA start to get shorter. I reckon the harm is done before the cell even realizes what is happening.

  46. Comment by AdR — October 18, 2007 @ 4:14 pm

  47. Bradford Says:
    October 18th, 2007 at 4:32 pm

    Raevmo: Transfer of mitochondrial DNA to the host genome also has benefits because it can prevent genetic conflict between host and slave.

    AdR: So, you first have genetic conflict (whatever that may mean, but it must not be good for the cell) and then the cell starts to transfer DNA. Wouldn't it be a little too late for that?

    Or to put it another way what is the time frame during which responses occur and does cellular replication cease for both the host and the consumed unicellular organism during the adaptive phase?

  48. Comment by Bradford — October 18, 2007 @ 4:32 pm

  49. Doug Says:
    October 18th, 2007 at 4:37 pm

    Besides, it would be boring if everybody agreed with Albert's post, wouldn't it?

    I'm not saying you have to agree with it. I just thought you were carelessly waving it off with the "no problems".
    I wanted to hear some objections to it, and I like your point about the origin of chloroplasts.

  50. Comment by Doug — October 18, 2007 @ 4:37 pm

  51. AdR Says:
    October 18th, 2007 at 4:37 pm

    Raevmo,

    After all, our own genome is littered with insertions of ancient transposons and virusses (you know, junk DNA), and we're still here, aren't we?

    Not surprisingly maybe, I don't think your assumption about junk DNA is correct. We see more and more functions of the so-called junk DNA.

    I do have problems with chloroplasts in the sense that they form from preplastids. Don't see how you retrogradely fit preplastids onto plastids without corrupting the function of the endosymbiont chloroplast.

  52. Comment by AdR — October 18, 2007 @ 4:37 pm

  53. Raevmo Says:
    October 18th, 2007 at 7:29 pm

    Hoi Albert, je schreef (translation: Hi Albert, you wrote):

    Raevmo, I don't see what scenario you are referring to. The apparent fitness advantage for the host is supposed to be aerobic respiration, so I assume that oxygen is needed in order to be functional. If we have an facultative aerobe, it already had aerobic respiration. Maybe you mean facultative anaerobic in the sense that the host had peroxisomes in order to prevent itself to the harmful effects of reactive oxygen species.

    Yes, that's what I mean. Perhaps I didn't explain it carefully enough. The host (facultative aerobe implies facultative anaerobe, doesn't it?) could handle aerobic conditions already, presumably because it had peroxisomes as oxygen sink.

    t's funny that you mention peroxisomes, as people once thought they were endosymbionts but now evidence seems to point to en origin from the ER. I like to point out that the peroxisome possesses many of the charcteristics of mitochondria, including protein targeting and division.

    Well, it's apparently still quite mysterious where peroxisomes came from, but de Duve (2007) argues that they predate mitochondria. It's an open question.

    Do you you of any bacteria that initially export ATP? What was the advantage from the hosts point of view? What advantages had the endosymbiont?

    There arewell-known modern-day symbioses between cyanobacteria and eukaryiotes, so it's obviously possible, whatever the mechanism.

    So, you first have genetic conflict (whatever that may mean, but it must not be good for the cell) and then the cell starts to transfer DNA. Wouldn't it be a little too late for that?

    When you have sexual reproduction and endosymbionts are transferred via the female line (as they are nowadays), then endosymbionts try to not end up in male offspring. This is a well-known phenomenon. For example, there are mitochondria in plants that prevent the plant from making pollen because the mitochondria have no interest in making pollen because pollen do not transfer mitochondra. That's genetic conflict between nuclear and mitochondrial DNA.

  54. Comment by Raevmo — October 18, 2007 @ 7:29 pm

  55. AdR Says:
    October 19th, 2007 at 6:59 am

    Reavmo, one of the indications that there is no theory is that there are many different scenarios, and that we do not know the host or the endosymbiont. There are a lot of assumptions to be made in order to explain the endosymbiotic theory. Of course you can come up with scenarios in which unknown ancestors cells fuse with other unknown cells to create new unknown organisms that evolve through an unkonwn mechanisms into mitochondria. Everyone is free to believe those scenarios, but they are far from scientific fact, but mere speculation. Lynn Margulis comes up with many chimeric bacteria and many sequential endosymbiotic events. Still the mechanistic problems remain.

    Of course there are well-known symbioses between bacteria and eukaryotes. The question here is whether they can be a model for the endosymbiotic theory. I think not because those endosymbionts are still bacteria. They do have a reduced genome, probably the reason why they are obligate endosymbionts in the first place, but you can only call the genome of mitochondria reduced if you accept the endosymbiotic theory. To me, it is the other way around: mitochondria acquired DNA and some more than others.

    The genetic conflict you describe is too teleological for me, just as enslavement. The way you depict it is that mitochondria have some sort of intrinsic goal. Just like enslavement, I like to see how this mechanistically happens. The way Cavalier-Smith describes the enslavement of mitochondria really does not fit in a darwinian framework, but more in a 19th century Lamarckian setting. We should know better now that we knwo how genetic information is transduced.

    PS Spreek of ben je Nederlands?

  56. Comment by AdR — October 19, 2007 @ 6:59 am

  57. Raevmo Says:
    October 19th, 2007 at 1:55 pm

    AdR:

    Reavmo, one of the indications that there is no theory is that there are many different scenarios, and that we do not know the host or the endosymbiont.

    Well, I guess it depends on what you mean by theory. I'm perfectly happy to call the endosymbiont theory a "theory" even though it's not established fact, as you say. I consider it fairly likely that mitochondria are derived from sulphur bacteria and chloroplasts from cyanobacteria, so I think we can be fairly confident that we know the endosymbionts, but if you don't feel that way, fine by me. I agree that many mechanistic details are missing, but given that it happened so long ago it's marvelous that we can learn so much anyway.

    PS Spreek of ben je Nederlands?

    Beide.

  58. Comment by Raevmo — October 19, 2007 @ 1:55 pm

  59. JOHN_A_DESIGNER Says:
    October 19th, 2007 at 3:51 pm

    Albert wrote:

    JOHN, I think the reason might be that evolutionary scientists that determine consensus are not engineers, but chemists. They don't see evolution as a system, but as a cascade of biochemical processes and fail to recognize the functional modules. As the interface is often represented by a chemical signal, they study the signal instead of its effector.

    It was Michael Behe's book, Darwin's Black Box, that opened up the world of biochemistry to me. (Though I am still very much a neophyte) Behe demonstrated to me that near and at the molecular level of the cell we have molecular structures that operate very much like machines. I would argue that, in fact, they really are machines. How are they really any different? Of course, the flagellum is a great illustration of this. Before Behe all chemistry to me seemed similar to making Jello. You know, throw in a package of the right ingredients, add some water and the right amount of heat and voila after if cools you get something different emerging out of the goo. To me cellular life was once just like Jello. But now for me the cell has become staggeringly complex, with many different kinds of machines acting together in a complex, intricate and coordinated manner, with some sites dedicated to manufacturing others energy production, others to waste management etc. all tied together within a vast interconnected communications and transportation network. How did the unguided forces of Nature ever create such a system? Or, is there something within or perhaps outside of Nature that we still do not understand? If the answer to the second question is "no" then someone should be able to give me a detailed step-by-step answer to the first question. Shouldn't they?

    By looking at cellular life from an engineering perspective I have gained a deeper, if not profounder, appreciation of how it all works. (Though not how it originated.) Maybe biochemists and other naturalistically oriented scientists would gain a deeper appreciation of why some of us are so skeptical of the tired old wave of the hand Darwinian arguments if they would consider the problem from a design and engineering perspective. What do you think?

  60. Comment by JOHN_A_DESIGNER — October 19, 2007 @ 3:51 pm

  61. AdR Says:
    October 19th, 2007 at 4:15 pm

    Raevmo, it is important to realize that the endosymbiotic theory is just a theory that sounds nice, but lacks substantial evidence and a mechanism. On the contrary, there are mechanistical reasons that make it very unlikely. So, even though you may think it is fairly likely, it may still be not true.

    What if the endosymbiotic theory is not true? I know hundreds and hundreds of papers with phylogenetic data that are interpreted in the context of the endosymbiotic theory. Data is even calibrated on the assumption of the endosymbiotic theory. If untrue, we have to re-evaluate all these data, including the dogma that prokaryotes preceded eukaryotes in evolution.

    Evolutionists think that because bacteria have a lower complexity, they appeared also earlier in evolution than eukaryotes. However, we have to see what evolutionary scenario is less complex. The eukaryotic genome with exons and more RNA relics are far more likely to have appeared first because it is relatively easy to build multimodular proteins from exon shuffling.

    Our entire concept of early evolution seems to be based on a few unproven assumptions that refer to each other. The endosymbiotic theory assumes the late acquisition of aerobic respiration by eukaryotes, a very important aspect of evolution. Early respiration is based on the assumption that stromatolites represent fossils of bacteria, instead of an artifact. The fact remains that we have no clue how early life looked like and how it came about. We do seem to fantasize about chimeric bacteria, multiple endosymbioses, lots of LGT which can explain away any problems in trees, or you can just pull the old long/short branch attraction, outgroups. If all that doesn't work, just enter neutral evolution.

    I think the extreme reliance on the endosymbiotic theory is not justified and is the reason why we don't have mechanistic scenarios: it just didn;t happen according to our consensus.

    I would like to stress that there are other scenarios that do conform to darwinian theory and offer a mechanistic gradual sequence of events. It is based on an early genome with exons (see de Roos 2005, 2007), with eukaryotic transcription machinery, an early cell that looked like our nucleus (de Roos, 2006), that was followed by membrane extensions to form the ER, Golgi and perhaps protomitochondria.

    Although it is difficult or even impossible to find real evidence, we do have a good knowledge of how things work in a cell (developmentally). If we can now deduce evolutionary events by just studying the mechanism we do have a predictive framework. That's exactly what evolutionary science is lacking.

  62. Comment by AdR — October 19, 2007 @ 4:15 pm

  63. AdR Says:
    October 19th, 2007 at 5:21 pm

    JOHN,

    You're absolutely right, it is nothing more than a molecular machine, and you need to analyze the functional components and how they communicate with each other. I myself use my knowledge of software systems where design patterns are used in the creation of complex systems. I argue that the design 'best practices' that we have created in order to make very complex and evolving software is also applicable to evolution. I myself look at the functional modules and their interface, i.e. input/output relations and my working model is that evolution shows the hallmarks of a system based on design-by-contract.

    You need to think like an engineer otherwise you won't understand a complex system. Evolutionists study DNA data but without understanding the system behind it. It's like trying to understand Windows XP by looking at the machine code, and it is impossible to create XP using an old 'procedural' programming. Biochemistry is necessary to identify the components of the system and how they are turned on and off by biochemical signals.

    You refer to the cell as staggeringly complex, but that may be just your unfamiliarity with biology. If I look under the hood of a car, or at the code for XP, it seems pretty complex to me. But if they explain the components and how they interact, I do not have to be a car mechanic or a .NET programmer to understand it. I only have to understand the design. The same with evolution: if I understand the design (what the system does and how its components work towards that goal), the complexity will be reduced. My guess that the introduction of chemistry in evolution will be followed by a revolution in engineering. Engineers will be the ones that will explain how it works in abstract terms. Biochemistry will just be the physical implementation of the abstract design, and can be completely modelled by software.

    That also one of the paradoxes now in evolution. In order to move to a strictly mechanistic world view as many atheists would like to, you need to introduce concepts like design, and goal-orientation, things you recognize from your own work in engineering.

    For myself, I am striving to explain evolution in purely mechanistic terms, and I am pretty certain that we eventually will come up with a plausible scenario. What I am not sure of, is whether randomness and natural selection will be sufficient driving forces for it. I do not want to exclude that we end up with some Natural Laws of complex systems. Like the laws of Physics, we know they exist, we know how to work with it and predict, but we don't know the essence of it.

    Engineering shouls also be able to learn from evolution. We have not been able with our software to create real evolving life without without some form of predisposition in its code. Maybe life will give us the answer how to create something like that, maybe we will be always in need of something extra.

  64. Comment by AdR — October 19, 2007 @ 5:21 pm

  65. Bradford Says:
    October 19th, 2007 at 5:41 pm

    AdR,

    My guess that the introduction of chemistry in evolution will be followed by a revolution in engineering. Engineers will be the ones that will explain how it works in abstract terms. Biochemistry will just be the physical implementation of the abstract design, and can be completely modelled by software.

    That also one of the paradoxes now in evolution. In order to move to a strictly mechanistic world view as many atheists would like to, you need to introduce concepts like design, and goal-orientation, things you recognize from your own work in engineering.

    For myself, I am striving to explain evolution in purely mechanistic terms, and I am pretty certain that we eventually will come up with a plausible scenario. What I am not sure of, is whether randomness and natural selection will be sufficient driving forces for it. I do not want to exclude that we end up with some Natural Laws of complex systems. Like the laws of Physics, we know they exist, we know how to work with it and predict, but we don't know the essence of it.

    Mechanistic processes themselves can supply evidence for design IMO. One can have an understanding of the biochemical properties of DNA and DNA's biological function and conclude that the DNA's basic coding property is not the result of a chemically based cause. Neither would its origin be attributable to a random selection scenario. There is no reason to think that a selection paradigm is the default choice for the cause of life's origin.

  66. Comment by Bradford — October 19, 2007 @ 5:41 pm

  67. Steve Petermann Says:
    October 20th, 2007 at 12:08 am

    AdR,

    You refer to the cell as staggeringly complex, but that may be just your unfamiliarity with biology. If I look under the hood of a car, or at the code for XP, it seems pretty complex to me. But if they explain the components and how they interact, I do not have to be a car mechanic or a .NET programmer to understand it. I only have to understand the design.

    The same with evolution: if I understand the design (what the system does and how its components work towards that goal), the complexity will be reduced.

    As a designer of complex systems for over 30 years this has not been my experience at all. Acquiring a cursory understanding of high level concepts of OOP like modularity, encapsulation, inheritance, interfaces, etc. may seem to reduce the complexity but once one gets down in the weeds of the details of such a system the staggering complexity is overwhelming. I don't know your experience but I have found that those who just deal with high level design have a radically simplistic perspective on the complexity of design versus those who have to actually deal with the details. At a high level an operating system like XP might seem relatively simple but it has taken millions of man hours of detailed work with billions of decisions to actually get something that works.

    Let me offer an example. It has been shown that the average person can maintain 2 or 3 threads of thought at once, like driving, talking on a cell phone, and thinking about what to have for dinner. Scientists are able to maintain a few more. Operating systems engineers have to be able to process at least 7 threads of thought at once because of the complex relationships that are effected. If this is what is required by intelligence to create the systems we have, which pale in complexity to the systems we find in biology and particularly the body, how likely is it that these biological systems just came about by chance?

    I predict that as nanotechnology matures, the unbelievable challenge to design even simple systems that relate and interact with the rest of biotic systems, the awe of biological design will reach epic proportions.

  68. Comment by Steve Petermann — October 20, 2007 @ 12:08 am

  69. AdR Says:
    October 20th, 2007 at 2:14 pm

    Bradford, I think it is well possible that we RM+NS are not enough to create this type of complexity. I do think RM+NS may be sufficient for adaptation.

    I am thinking now in the line of the emergence of intelligent systems that evolved through natural selection that would facilitate evolution. Active mechanisms for exon shuffling, transfer of complete modular coding units etc.

    As for natural selection, I do not like the model in which a single inidvidual with a advantageous mutation will after many generations will have spread through the population. It would be more likely that after a change in environment for instance, that only those individuals would survive that can handle this change. Basically the founder effects.

  70. Comment by AdR — October 20, 2007 @ 2:14 pm

  71. AdR Says:
    October 20th, 2007 at 3:02 pm

    Steve, I see what you mean and you could be right that at the detailed level the complexity is still overwhelming. We do have to model the overall structure before we get in the details though, and for both we need engineers. Perhaps Nature can teach us new design patterns. After all, the complexity we can model now with OO programming and distributed systems is more than we could imagine when we were still working with first and second generation computer languages.

    If I reverse engineer gross evolutionary scenario for evolution, I find scenarios that are already less complex than mainstream evolutionary science comes up with. On the other hand, like you, modeling simple metabolic house-keeping functions is already complicated, let alone multiple systems that can potentially interfere.

    Development also is enormously complex with multicellular organisms devloping from a single fertilized egg, and even though we hardly understand how it happens (it would also need a systems approach), I can see it as a perfect little molecular machine and eventually reducibly complex. My assumption is that evolution, development with an extra time (life cycle) dimension may be as well reducibly complex.

    If we look at development, all the processes seem to have a near 100% success rate. Almost all cell divisions, the result of 100s of subprocesses. Although I can't say I fully understand how it is done, it tells me that the system itself has been made full proof with self-assembly, check points, binary decisions, feedback and forward mechanisms etc.

  72. Comment by AdR — October 20, 2007 @ 3:02 pm

  73. JOHN_A_DESIGNER Says:
    October 22nd, 2007 at 3:49 pm

    Albert wrote:

    You refer to the cell as staggeringly complex, but that may be just your unfamiliarity with biology. If I look under the hood of a car, or at the code for XP, it seems pretty complex to me. But if they explain the components and how they interact, I do not have to be a car mechanic or a .NET programmer to understand it. I only have to understand the design. The same with evolution: if I understand the design (what the system does and how its components work towards that goal), the complexity will be reduced.

    (Adding to what Steve has already said) It sounds like me that you are confusing concept with design. For example the concept of a liquid fueled rocket engine (at least in terms of the physics) is relatively simple. It is simply a device designed to create thrust (or an equal and opposite reaction) to propel a specific payload at a specific velocity over a specific distance. Designing something that accomplishes that task in the real world, like launching astronauts safely into space is enormously complex, not to mention difficult and dangerous. As a real world designer it is my task to take a concept and turn it into something that really functions usefully in the real world, and hopefully on time and on budget. In other words, I take concepts and tell the manufacturer how to specifically turn it into reality.

    NASA has spent millions of dollars on concepts that have appeared, at least to a lot of smart people, to be possible, only to find out after some detailed study that the idea was not feasible, at least using technology would be available in the near future. For example, the idea of a single stage earth to orbit space plane was scuttled after much study in the mid 1990's. Ironically, current plans have NASA returning to a capsule style spacecraft by 2012. Talk about taking a couple steps backwards.

    I have no doubt that the idea of Darwinian or naturalistic evolution is a very compelling concept. The problems, however, are not broad conceptual ones, but ones of practical details. How do abiotic chemicals organize them selves to become self replicating? What is the process? What are the steps? What were the necessary precursor conditions? What is the minimum requirement for an organism to be evolvable? These kinds of questions are practical how-to kind of questions. They are, in my view, the kinds of questions that we need to be asking if we are ever going to determine the potential and limits of any kind of real world natural evolutionary process. Those are the kind of questions that lead to real understanding and knowledge.

  74. Comment by JOHN_A_DESIGNER — October 22, 2007 @ 3:49 pm

  75. AdR Says:
    October 22nd, 2007 at 5:16 pm

    JOHN, I agree that the questions you mention need to be asked, and I myself try to answer these. In real terms of functional proteins and how they can be arranged to create self-regulating or self-assembling molecular machines. I use design not as a concept, but as an actual implementation of a concept. I argue that, in order to create a self-evolving complex molecular machine, you need to apply the rules of design-by-contract. The interfaces are very specific, for instance the interface for translation is a physical strand of RNA whose nucleotides are arranged according to the genetic code.

    Take the mitochondrion, a good picture is here. It basic unit consists of an impermeable vesicle that uses the potential energy of a proton gradient to create ATP, an important fuel for many processes. In theory, it needs only two (!) proteins: one that uses the proton gradient to generate ATP, and a second that uses another molecule (NADPH) to create the proton gradient. Add a feedback, and you could regulate ATP production.

    I have the same worries about the complexity of evolution as you, but I have the same with development. Although it is very hard to believe that from a fertilized egg can grow an adult human being. Even in children with birth defects, millions of other processes have worked. But I see it happening with my own eyes, and however complicated it is reducible to a set of instructions that code for a system. Systems with one level lower complexity of evolution (development) exist, which makes me believe that naturalistic processes exist with an extra time dimension (evolution).

    I naturally assume that we will be able to build Life in silico as software models, or in real life by nanomachines. But prove me wrong, because I do think we need new design patterns in order to emulate evolution.

  76. Comment by AdR — October 22, 2007 @ 5:16 pm

  77. JOHN_A_DESIGNER Says:
    October 23rd, 2007 at 11:16 pm

    Albert wrote:

    I argue that, in order to create a self-evolving complex molecular machine, you need to apply the rules of design-by-contract. The interfaces are very specific, for instance the interface for translation is a physical strand of RNA whose nucleotides are arranged according to the genetic code.

    But where in your opinion does the genetic code come from? Is it something that pre-exists in nature? Is it somehow intrinsic in organic molecules? Is it something that emerges from matter? Or, is it somehow imposed upon matter? If it is the latter what or perhaps who imposes the information? IMO these are the fundamental questions we need to begin with to answer the question of how life originated and how it evolves.

    Take the mitochondrion, a good picture is here. It basic unit consists of an impermeable vesicle that uses the potential energy of a proton gradient to create ATP, an important fuel for many processes. In theory, it needs only two (!) proteins: one that uses the proton gradient to generate ATP, and a second that uses another molecule (NADPH) to create the proton gradient. Add a feedback, and you could regulate ATP production.

    I'm not quite sure I understand your point here. Are you saying that mitochondria resemble some sort of proto cell? I know they reproduce but can they (do they?) exist on their own outside the protective environment of their host? Are they evolvable? You seem to be suggesting that mitochondria are very simple, but does this simple existence really lean anywhere?

    Although it is very hard to believe that from a fertilized egg can grow an adult human being. Even in children with birth defects, millions of other processes have worked. But I see it happening with my own eyes, and however complicated it is reducible to a set of instructions that code for a system. Systems with one level lower complexity of evolution (development) exist, which makes me believe that naturalistic processes exist with an extra time dimension (evolution).

    Good point! I don't think that even the staunchest creationist would argue that biological reproduction and development is a result of Gods continuous creative activity. However it does not necessarily follow that every living thing in the world is the result of some completely autonomous natural process. When I look at the development of some living organism I know that there is a continuity of natural causes. However, I don't have that same kind of assurance when I look at the much larger span of evolution. Instead of continuity I see a lot of discontinuity. Of course, as I am sure you know it has been argued that this discontinuity is only apparent. However I think that is a big mistake. I think we should also consider the possibility that the discontinuity is real. It might be after all, some unknown natural process that no one presently understands. That has happened before in science. A relatively small anomaly led to a whole new field of physics. Are you familiar with Planck and the problem with black body radiation? BTW you don't have to be a Design Theorist to think like this. You only need an open but critical mind and a willingness to think outside of the box of conventional science.

  78. Comment by JOHN_A_DESIGNER — October 23, 2007 @ 11:16 pm

  79. AdR Says:
    October 25th, 2007 at 10:00 am

    Hi JOHN,

    The genetic code is a difficult one. I assume that it came about as an extrension to an already replicating RNA molecule (my model for the OOL is a polymerase chain reaction driven by day/night cycle) by purely mechanistic causes. I also think that the way it was assembled in evolution can be reverse engineered.

    I wonder about the driving forces, though. I assume it just happens, driven by the need to replicate, but it still needs to be based on a very robust, yet flexible system. This robustness and flexibility is normally reflected by a design, and in a mechanstic view, this also had to be able to evolve. Which makes it sort of a chicken-egg problem.

    I spend quite a lot of time on the genetic code, but it's quite complex and I haven't had the time to really look into into it. Mechanistically, we have worked it out quite well, but there seem to be a couple of interdependent systems there. There must be an easy way to assemble this piece of machinery. One of the problems is that the functions biochemists gave to the components may not have been identical to its orginal function. Actually, I am pretty sure that if we translate the functions imvolving the genetic code in purely abstract terms, a bunch of engineerd should be able to figyre out how to assemble such a structure. Of course, here as well counts that we may knwo how it was assembled, but we still don;t how what drove it (monkeys or intelligence?)

    What I was trying to say is that the function of the mitochondrion can be seen as a simple autostat where a number of feedback and forward systems create an independent unit can can react to changes in actual food supply or demand (cf. a thermostat). That could have been the evolutionary driving force: an energy-generating unit that works in each cell, where each cell can depend on it to work, which due to its simplicity never fails and which only need to be finetuned. (Many questions in evolution can be answered by wondering how a designer would do it.)

    If it is true what I think and that true evolution as the creation of new function is something else than adaptation (and even the opposite), then we are only at the beginning of a new era. I am sure all our concept will change so we should remain open to all sides indeed. I think the next revolution in biology should come from engineering (1960-present was mostly chemical).

    In cancer biology you can see the current situation. They talk about chsck points and molecular switches, but they don't understand what these swichtes turn on. They find many chemical cascades that converge and diverge but they don't knwo on what functionality. Maybe they focus on the interfaces (chemical) but fail to see what functionality lies behind it.

    I'll look into the black box radiation!

  80. Comment by AdR — October 25, 2007 @ 10:00 am

  81. JOHN_A_DESIGNER Says:
    October 25th, 2007 at 3:59 pm

    Albert, You wrote:

    I wonder about the driving forces, though. I assume it just happens, driven by the need to replicate, but it still needs to be based on a very robust, yet flexible system. This robustness and flexibility is normally reflected by a design, and in a mechanstic view, this also had to be able to evolve. Which makes it sort of a chicken-egg problem.

    I am sure you already know that both in DNA and RNA the nucleotides (A,T,C,G in DNA or A,U,C,G in RNA) bond in a specific predetermined way. For example, with RNA, (In keeping with the fashionable "RNA first" scenario) A always bonds with U, and C always bonds with G as is illustrated by the following:

    C A A G U A G G G
    ↨ ↨ ↨ ↨ ↨ ↨ ↨ ↨ ↨
    G U U C A U C C C

    However, this law only applies along the "rungs"(vertically in the example above) of the RNA molecule. If we look horizonally along the sides we find that the chemical bonding is completely different. For example, consider the following strand of RNA:

    CAAGUAGGGAGUUGAUAAGGGAUAUAAUCACAAGUAGUACA >(continues)>

    AGU AUCAGGGUCUAAAACUGGGAGUUGAUAAGGGUCUGCAAUUAGA

    Now, what affinity do any of the chemicals have with each other, in the horizontal? According Michael Polanyi and others, the bonds along the side between C,G,A,U do not have any deterministic affinity. One can arrange them any way one wishes, randomly or purposely with some kind of code. For example, in the above strand I've encoded a brief message in English.

    Now there are only few ways IMO that we can logically explain how the original code got into the first RNA molecules: (1)chance (2) intelligence (3)some unknown natural law or (4)the genetic code is somehow eternal.

    Personally I believe that we can quickly eliminate #1 and #4. All basic calculations show that trying to assemble even a simple hypothetical "replicater" one quickly uses up all the time and chance that is available in the universe. As for #4, how can you have something eternal in a non-eternal universe?

    But if we consider #3 wouldn't those new laws act something like intelligence?

    Do you agree with me, or do you think that there is still a possible explanation using currently understood natural law?

  82. Comment by JOHN_A_DESIGNER — October 25, 2007 @ 3:59 pm

  83. AdR Says:
    October 26th, 2007 at 12:09 pm

    Hi JOHN,

    I agree it is not random, yet it could have come about by random processes in a gradual manner where each of the substeps have somehow an advantage over previous steps. Selection of those in a population could lead to progression. At least, this is the mechanistic, and I believe Darwinian, framework that I use as a null hypothesis. I am willing to try any other possibilities if this proves to be insufficient, and I believe we approach the genetic code wrongly. This counts for both the neodarwinists as well as the ID people.

    Some considerations:
    The genetic code is called redundant (although I myself do not know whether the code is redundant because I don't know the reason why it evolved, so I cannot call it redundant) meaning that more than one codons can code for a single amino acid. I see it differently: the first nucleotide originally determined the amino acid, leaving 4 possibilities. In time, more amino acids were added that started to use the second and later third place in the codon. You see the gradualism in here, which can also be seen from the type of amino acids often belonging to one chemical class. My gues that this would already reduce complexity.

    Also, a 100 amino acids long protein does not have to be made in one piece and I think that system design even predicts that you can only assemble a multifunctional proteins by firdt creating the individual modules and then assemble them. So maybe we're talking about 10 amino acid long modules.

    Those moduels do not have to be functionally active. In my latest introns article I proposed that small ancient exons (that are concatenated to generate the full protein) could have been used to generate a diversity of proteins from which only the active modules are pulled out. So like the individual LEGO blocks do not contain a function by itself, 10 of them may form a bridge. I do think of an active (ribozyme-based) mechanism that shuffles the exons.

    I also think that there was a earlier function of the genetic code. Not to make the proteins we know, but simpler proteins with maybe one or two amino acids. I am struggling with what this could be though maybe structural (poly-Gly). What was/could have been the initial selection? Besides codon 'assignment', we also have amino acid assignment to the tRNA, but what was first.

    Current literature thinks of the code as a 'survival of the fittest code', but they largely ignore the mechanistic effects. It is not easy to reassign codons as all downstream proteins would be affected (crick's frozen accident). I have not seen real mechanistic approaches, so I think we could still make progress in this field.

  84. Comment by AdR — October 26, 2007 @ 12:09 pm

  85. God's iPod - Uncommon Descent - Intelligent Design Says:
    April 11th, 2011 at 5:12 pm

    [...] endosymbiosis up against? T. Cavalier Smith is said to note: "The origin of the eukaryotic cell was the most complex transformation and elaborate example [...]

  86. Pingback by God's iPod - Uncommon Descent - Intelligent Design — April 11, 2011 @ 5:12 pm

Leave a Reply

You must be logged in to post a comment.

  • Featured Books


    The Design Matrix: A Consilience of Clues by Mike Gene
    Your Inner Fish: A Journey into the 3.5-Billion-Year History of the Human Body

    Catalyzing Inquiry at the Interface of Computing and Biology

    System Modeling in Cellular Biology: From Concepts to Nuts and Bolts

    The Plausibility of Life By Marc W. Kirschner and John C. Gerhart

    Agents Under Fire by Angus Menuge

    Life's Solution by Simon Conway Morris

    Information Theory, Evolution and the Origin of Life by Hubert P. Yockey

    The Fifth Miracle by Paul Davies

    Nature, Design, and Science by Del Ratzsch

    Origination of Organismal Form by Muller & Newman

    Biased Embryos and Evolution by Wallace Arthur

    Rare Earth by Peter Ward and Donald Brownlee

    The Privileged Planet by Guillermo Gonzalez and Jay Richards

    The Way of the Cell by Franklin Harold

    The Volitional Brain by Benjamin Libet

    Evolution in Four Dimensions by Eva Jablonka & Marion Lamb

    The Evolution-Creation Struggle by Michael Ruse




Telic Thoughts is proudly powered by WordPress
Hosting provided by TopSoftware4Download.com .

Entries (RSS) and Comments (RSS).