A Third Choice (ID Hypothesis)
by MikeGene[Here is a guest post from TT member, Thought Provoker]
Front Loading is a popular hypothesis among the earnest ID scientists. Whether these scientists refer to it by name or just in general concepts, they are looking for the answer to ID's "innocuous question" by searching for biological solutions that presume later biological needs. A designer-centric term for this would be "planned". A mainstream scientific term would be "supernatural". For the Third Choice model I suggest "retrocausal" (a generalized observation of an action occurring before a cause.) While "retrocausal" normally implies time travel, we need a looser definition due to the lack of appropriate candidates in the English language. For example, a soft retrocasual example would be the action of someone taking an umbrella out of the closet and carrying it before it rains. This is the designer-centric 'planning". A hard retrocausual example would be precognition. This is mainstream's "supernatural".
Retrocausalty alone isn't enough to explain design. We also need an organizing process or agency. The designer-centric answer is "the designer did it". The mainstream answer is "nature selection did it". The Third Choice involves interconnected quantum effects.
Chapter 1 "“ Quantum Weirdness is real
Quantum mechanics is the foundation of all matter, living or not. It has been understood since the 1930s that quantum mechanics expresses "quantum weirdness" which is more formally known as the Einstein, Podolsky, and Rosen (EPR) paradox. In over 70 years and countless experiments science is forced to conclude something fundamental has to give. I feel the Greenberger-Horne-Zeilinger (GHZ) states presents the fundamental issues the clearest.
Imagine we have three observers (Alice, Bob and Cecilia) ready to measure entangled photons that head out in three different directions; One to Alice, another to Bob and a third to Cecilia. Each observer has a choice of which polarized state to measure (linear or circular).
The first bit of weirdness is that if two circular measurements are made, the results will determine the linear polarization of the remaining photon. The two polarizations should be independent of each other but they are not. If Alice measures a clockwise (R) polarization and Bob also measures clockwise (R) polarization then Cecilia will ALWAYS measure a vertical (Y) polarization if she chooses to measure linear polarization. (RRY)
If Alice measures a clockwise (R) polarization and Bob measures a counterclockwise (L) polarization then Cecilia will measure a horizontal (X) polarization if she chooses to measure linear polarization. (RLX).
It doesn't matter which observer is the odd-man-out or in which order the observations are made. All of the mixed observations possibilities are"¦
RRY YRR RYR
RLX XRL RXL
LLY YLL LYL
LRX XLR LXR
XXL XLX LXX
XYR XRY RXY
YYL YLY LYY
YXR YRX RYX
So far this doesn't exhibit anything like retrocausual or superluminal weirdness. It could be explained classically (algorithmic and static states). But what happens if the first two observer's measurements are horizontal polarization (X) and the third observer chooses to also measure linear polarization?
Let's work with what we know. We know if the observer measured circular polarization the answer would be counterclockwise (L as in XXL). With that, we can figure out the circular polarizations of the other two photons (they would be R) because XRL and RXL are the only alternatives that fit.
Therefore, we have an RR? situation. Which forces RRY as the answer. Which means Y would be the expected linear polarization in the case of XX?.
Classically, the answer must be XXY.
Experimentally, the answer is XXX!
Quantum mechanics gives the opposite result of what classical physics would dictate. This is not a logic error. This is not an experimental error. This is a real paradox. There are only a limited number of answers to this paradox..,
1. Ignore it
2. Assume a metaphysical construct (Multi-world interpretation)
3. Assume retrocausality
4. Assume interconnected, non-local quantum effects
5. Assume both retrocausality and interconnected quantum effects
The tendency to reject retrocausality is due to a presumption of a casual paradox. What happens if you kill your ancestors? With quantum mechanics, that isn't a problem. The situation is too tightly controlled. Observation forces the issue. Casual paradoxes can't happen.
The difficulty with interconnected, non-local quantum effects is that is sounds too magical and occurs faster than the speed of light. Superluminality is a problem because it inherently implies retrocausality.
The Third Choice offers no benefit if it is just another metaphysical argument. Therefore, we will forge ahead and presume the quantum effects are really real.
But what is the reality if a quantum state is never observed? This get's into the Schrodinger's cat paradox. If the cat lives or dies based on a quantum state, is the cat both dead and alive (superposition) pending an observation? Penrose has a suggested answer for the paradox.
Chapter 2 "“ Penrose OR
The Penrose has a model is called OR (objective reduction)"¦
Penrose considered superposition as a separation in underlying reality at its most basic level, the Planck scale. Tying quantum superposition to general relativity, he identified superposition as spacetime curvatures in opposite directions, hence a separation in fundamental spacetime geometry. However, according to Penrose, such separations are unstable and will reduce at an objective threshold, hence avoiding multiple universes.
The threshold for Penrose OR is given by the indeterminacy principle E=ħ/t, where E is the gravitational self-energy (i.e. the degree of spacetime separation given by the superpositioned mass), ħ is Planck's constant over 2π, and t is the time until OR occurs. Thus the larger the superposition, the faster it will undergo OR, and vice versa. Small superpositions, e.g. an electron separated from itself, if isolated from environment would require 10 million years to reach OR threshold. An isolated one kilogram object (e.g. Schrodinger's cat) would reach OR threshold in only 10-37 seconds. Penrose OR is currently being tested.
Penrose's suggests that objective reduction does, in fact, create reality (at least as real as "reality" gets). While some physicists do not like this model because of what follows, it is the best game in town. The OR model is quantifiable and can be verified experimentally. So far, no experimental result has managed to falsify it.
So what forces quantum states to be what they objectively reduce to? One experimentally observable answer is consistency with multiple observers. Which quickly leads to the concept of universal consistency of all objective reductions. In other words, Orchestrated Objective Reduction or "Orch OR" for short.
Kurt Gödel's incompleteness theorems supports the possibility of non-algorithmic things existing in nature. IOW, there can be explanations that can't be explained. Penrose points to aperiodic tiling for his non-algorithmic explanation. Mathematically, it was shown that it is possible to completely cover a two dimensional plane with a distinct set of shapes ("tiles") and not end up with a repeating pattern ("aperiodic"). Penrose figured out two shapes that solved this puzzle. A solution that Penrose claims couldn't have been accomplished without the aid of a non-algorithmic process (pseudorandomness isn't sufficient).
It might be tempting to dismiss this as just a mathematical exercise and, therefore, not "reality". However, a decade after Penrose demonstrated his Penrose Tilings mineralogists discovered quasicrystals. Naturally occurring aperiodic crystals that matched Penrose Tilings.
Penrose claims that his ability, as a mathematician, to conceptualize non-algorithmic things is inconsistent with a computer only capable of algorithmic processing. Are Penrose's instincts correct that he solved the aperiodic tiling problem instinctually instead of algorithmically?
Chapter 3 – Penrose/Hameroff (Orch OR)
For the OR model, Penrose is pretty much in his element. If anyone could translate quantum weirdness into reality, it would be a man who models Black Holes for a living (along with Hawking). And his Penrose Tilings was just something he did as a hobby.
This chapter deals with subjects that Penrose admits could be totally wrong but, in his opinion, are more likely correct than not. However, the ideas are experimentally verifiable. And there have been experiments that have produced some intriguing results.
While he has made some mistakes, they were minor and the Penrose OR model is going strong, IMO. However, Penrose's ideas about consciousness are meeting fierce resistance. I find it ironic that people rationalize that Penrose's ideas about consciousness are totally disconnected from his brilliant work as a physicist. I just don't see a logical discontinuity here.
However, biology isn't Penrose's strong suit, so he teamed up with Dr. Hameroff to produce the Penrose/Hameroff model of consciousness (Orch OR). The first part on the Penrose/Hameroff model depends on Penrose's theories concerning objective reduction. The timing for objective reduction, T = ĥ/E, is something that can be tested and, undoubtedly, will be tested. Penrose has proposed an experiment FELIX in an attempt to test this hypothesis.
Even if Penrose is wrong about the details there is a threshold where quantum effects appear to give way to Newtonian physics. We don't see the same quantum weirdness with throwing baseballs around as we do with throwing electrons around.
While this simplifies the situation for Schrödinger's cat it has the potential of complicating things for smaller objects like Tubular Dimers. I found this 1999 presentation where Penrose explains his chain of logic from basic physics to microtubules. However, this presentation is old and Hameroff has mostly taken over explaining the biological explanation. www.hameroff.com is a good source for material on the Penrose/Hameroff model.
Here is a link to an experiment trying to verify Penrose/Hameroff"¦
In recent times the interest for quantum models of brain activity has rapidly grown. The Penrose-Hameroff model assumes that microtubules inside neurons are responsible for quantum computation inside brain. Several experiments seem to indicate that EPR-like correlations are possible at the biological level. In the past year , a very intensive experimental work about this subject has been done at DiBit Labs in Milan, Italy by our research group. Our experimental set-up is made by two separated and completely shielded basins where two parts of a common human DNA neuronal culture are monitored by EEG. Our main experimental result is that, under stimulation of one culture by means of a 630 nm laser beam at 300 ms, the cross-correlation between the two cultures grows up at maximum levels. Despite at this level of understanding it is impossible to tell if the origin of this non-locality is a genuine quantum effect, our experimental data seem to strongly suggest that biological systems present non-local properties not explainable by classical models.
Chapter 4 – The Third Choice
Enstien once remarked "God doesn't play dice." TT's Joy has expanded that to "God does not play dice. God plays a particularly mean game of billiards."
God doesn't play dice because there are no dice.
Imaging playing a dice game on an algorithmic computer that uses a pseudorandom number generator to decide which numbers come up. Even though this game could still be enjoyed by humans incapable of calculating the next number, it is not really random. Pseudorandomness could be used to simulate anything from a dice game to an evolutionary process occurring over billions of years. It wouldn't be actually random, just a simulation of randomness.
Is there such a thing as "natural" randomness?
Leaving living things out of the picture for the moment, any inorganic randomness can be traced to quantum mechanics and quantum mechanics isn't random. It is just non-deterministic.
Quantum weirdness defies algorithmic explanation. Quantum effects are clearly interconnected in space-time to all other quantum effects. The universe is totally interconnected at the quantum level.
It is impossible for one observer to see Schrödinger's cat dead while another one sees it alive so the paradox is prevented from happening in the first place. How? Through non-deterministic NON-RANDOM quantum weirdness.
Don't living things act randomly?
That pool shooting hustler pulled a fast one there. When life needed a randomizer, where do you think she got one? Via quantum mechanics of course. Quantum mechanics has been sewn into the very fabric of what make living things appear to be acting randomly.
Observation doesn't cause "random" objective reduction. It is just quantum weirdness being consistent with itself. The observer isn't acting random.
God plays a particularly mean game of billiards. She uses an invisible cue stick inscribed with the words "quantum weirdness". Not only can't we verify the existence of either her or her cue stick, we aren't even allowed to see the balls until they "poof" into existence right before our eyes via objective reduction.
Dr. Dembski can talk about Universal Probability Bounds all he wants, but unless it is absolutely impossible, God can not only make the shot, she can do it in such a way you won't be able to tell she did it much less how.
And, oh yeah. time is just another dimension of space-time. Quantum consistency includes the past being consistent with the future. Past, present and future are all interconnected. If God needs to, she can reverse cause and effect, retrocausality.
Chapter 5 – DNA, RNA and Microtubules
Here is a Hameroff discussion titled Quantum Computing in DNA
Hypothesis: DNA utilizes quantum information and quantum computation for various functions. Superpositions of dipole states of base pairs consisting of purine (A,G) and pyrimidine (C,T) ring structures play the role of qubits, and quantum communication (coherence, entanglement, non-locality) occur in the "pi stack" region of the DNA molecule.
Whether we are talking about a theist's pool shooting God or an atheist's universe just forcing consistency. Penrose's Orch OR model is practically running DNA processing according to Hameroff.
Another point that transcends metaphysical interpretation. Life is a natural outcome of enabling quantum mechanics. Living things can satisfy the needs of quantum consistency in ways non-living things can't. OOL becomes easy to explain. The game is rigged. If it can be done, God or a mindless universe has all the tools it needs with quantum mechanics. There is no such thing as randomness just forced consistency.
Rocks aren't very efficient at doing whatever the universe need done. However, living organisms contain microtubules that are very active with quantum effects.
Here is a link to a film clip that is a compelling argument all by itself.
Here is a link to a film clip of a neuron.
Chapter 6 – NOMA or OMA?
Gould's Non-overlapping Magisteria will always be a source of conflict. Can we separate the metaphysical from science? If we don't that we have to decide which version of the OMA Truth (capital "T") is reality. Personally, I think the Truth will be forever unknown and unknowable. Therefore, we can live with multiple Truths.
Sobottka made a good stab at presenting a verifiable, single OMA truth based on this model. It bothered me when I first read it. However, during the second read-through I figured out where he crossed the NOMA line. I'm not saying Sobottka did anything unethical or even that he is wrong, just that NOMA continues to live because there are still unknown and unknowable Truths.
If quantum mechanics is truly the embodiment of consciousness then EAM is the Truth by definition. Quantum mechanics is part of all matter that make up the universe. Personally, I am taking the more modest approach of assuming consciousness is just an artifact of quantum mechanics. I think of quantum mechanics as a non-deterministic, non-algorithmic, non-local process. A rock has little use for such a thing. It provides some value to quasicrystals. To wiggly, squiggly organic things it gives them an edge in the evolutionary process. To inorganic AI machines, it could cause a paradigm shift and probably will.
Personally, I am still holding on to my multiple NOMA Truths that include a purposeless predetermined Universe and an Ultimate Engineer (or Science Fair project). I will explain both of these in the light of the new Third Choice.
A predetermined Universe would be like a cosmic Mandelbrot Set. A Mandelbrot Set appears to be chaotic and "random" yet exposes patterns and design. If you picture the universe from outside space-time you would see time as just another dimension, therefore the universe is unchanging. Past, present, future is all fixed and consistent with itself. There are no discontinuities because the non-algebraic "equations" don't provide for it. The past is interwoven with the future. Time travel/retrocausality can and does happen but it doesn't cause a conflict because the whole Mandelbrot picture is unchanging. The universe just is.
God is an equally valid as a metaphysical model, IMO"¦
I can easily hold the notion that the universe is the Ultimate Invention of the Ultimate Engineers. For this non-engineer, I sometimes refer to it as a Supernatural Science Fair Project. The more I understand the more I am impressed. Surely a creation like this is worth a blue ribbon. But I can't know since I have nothing to compare it to even if I did, I wouldn't be able to fully appreciate either. But what about the fine tuning argument? Do you still think chance has anything to do with this? There are no dice. At least none we can see. This universe may be the only Mandelbrot Set that works. It is also possible that a designer got to choose. Either way, we will never know.
I am content with understanding, and being impressed by, the invention. If there is an inventor, I think it is a reasonable assumption that this is the best way to show our appreciation.



















July 1st, 2007 at 8:39 am
Great stuff, TP. We'll have to talk about the MT stuff, because it is a weak link. Then again, maybe my concerns have been addressed. But I have some ideas to help improve it.
Comment by MikeGene — July 1, 2007 @ 8:39 am
July 1st, 2007 at 10:42 am
TP
Thank you for such a decent look at this situation. your thoughts have helped me to get a bit further in my understanding of where science is going (as ive mentioned before science is not my strong field). i would only have a few comments (assuming that all your conclusions and what not are correct)….
what "evidence" or "preference" or whatever leads you to believe this statement? (also, unfortunatly, due to the cultural climate we now live in, Truth (cap T) will be expressed, as harris or dawkins do, as a public sphere thing to get us as a species forward with our goals, though they will try to pass it off as a real Truth of what is). Sam Harris even tries to do away with your statement (as a rortian statement) by saying, its a statement of what is, what the Truth is, and not all our statements can be compatible…i think harris is going about it in a rather freshmanly way but none the less people are listening, and i think thats were scientists and the like will go also.
would it ever be possible to sort out one of the three models (i believe you said God, the science project, or the multiverse) as the correct model or the most evidence based model? can we figure in the empirical obsevations made by prophets (of any religion) whom claim to have seen and spoken to a god? what about Jesus' claims of godhood (i find that he does claim so in the texts, however these are just texts with a tradition, and then the texts are backed by my own empirical observations, or what we may call the holy spirit (nephesh in hewbrew))? you must be finding some sort of "evidence" to prefer your choice of the science fair model over say any of the two. perhaps you are not all for saying "my preference must be everyones", but why is your preference what it is, and could we find any "universal" evidence to go one way or the other, or to prefer one over the other?
i am very interested in your answer.
durante.
Comment by dantedanti — July 1, 2007 @ 10:42 am
July 1st, 2007 at 10:47 am
Mike:
Hi, Mike. From what I've gathered, Orch-OR specifies MTs as mechanism. The amazing dynamics of MTs in living cells seem definitive of vitality itself. Not only are they big players in cellular mitosis, they also provide in-cell sensory processing, intracellular communications from membrane-in (signal transduction), transport, motility and cytoplasmic state control. Why, just yesterday another function of MT constructs was reported from Fox Chase Cancer Center researchers in the June 29 issue of Cell – cilia (MT constructs) as cellular "antenna", the loss of which leads to cancer.
The little You-Tube clip you posted (and TP links to) is a graphic highlight of cytoskeletal MT dynamics in action – from a distance that doesn't show us what they're actually doing. Scientists used to ignore MTs. It was just some structural stuff that was dismissible in favor of seemingly more 'important' specialized internal structures. But if Hameroff is right that MT constructs serve primary information processing functions, their further specialization and stability in neurons is very telling.
TP wants the mechanism (for expression/operation of attributes associated with consciousness in life forms) to be the whole story. I imagine all committed materialists wish for the same thing. That way we can just cut off the quest, declare it a done deal, and go back to our usual game of dueling metaphysics over interpretations. Science itself as a "science-stopper."
I'd like to hear your concerns about the MT link. I don't think it's a done deal yet!
Comment by Joy — July 1, 2007 @ 10:47 am
July 1st, 2007 at 11:12 am
To Mike – Thank you for the guest post.
To DanteDanti – See Joy's comment about "dueling metaphysics".
To Joy – See DanteDanti's comment as evidence of your predictive powers.
This is a great start to this thread. I will respond more fully shortly, but first a couple addendums.
Here is a link to a 1999 Penrose presentation I wanted to include.
Here is a link to a 1998 Hameroff paper presenting Orch OR and its possible impact (Did it cause the Cambrian Evolutionary Explosion?).
Comment by Thought Provoker — July 1, 2007 @ 11:12 am
July 1st, 2007 at 11:19 am
Hi Joy/TP,
Since I'll be doing that thought experiment shortly, I don't have the time to go into it much, but here's the deal. While I certainly agree about the importance of MTs on multiple-levels, and the mechanism angle is intriguing, the decision to focus on MTs seems arbitrary. More problematic is this: MTs are not biological universals.
But like I mentioned, I'm not a bomb-thrower, as I have ideas that may help (assuming I have nailed a serious problem, that is).
Comment by MikeGene — July 1, 2007 @ 11:19 am
July 1st, 2007 at 11:21 am
Hi Mike,
You wrote…
Thank you Mike. I am glad you liked it. It is tough trying to provide full explaination while not losing the audience due to the length of the post. I skimped on the microtubules part because I don't think of it as the weakest link in the logic chain.
At this point I would normally start explaining what I see as the weaknesses, but usually gets people confused when I do that.
So I will trust that this thread will get engender a critical comment or two or, maybe, even more than two.
Comment by Thought Provoker — July 1, 2007 @ 11:21 am
July 1st, 2007 at 11:54 am
Hi DanteDanti,
You wrote…
I am glad it was helpful.
I had written…"Personally, I think the Truth will be forever unknown and unknowable. Therefore, we can live with multiple Truths."
You asked…
what "evidence" or "preference" or whatever leads you to believe this statement?
Philosophically, I embrace the concept that wisdom comes from knowing that you don't know.
Scientifically, Penrose refers to Kurt Gödel's incompleteness theorems as mathimatical proof that somethings in nature can, forever, be non-deterministic (non-algorithmic).
I like this part of Penrose's model. I call it a definable NOMA wall that will prevent us from ever knowing the Truth. Is this the Truth? Well, I am wise enough to know I don't know the Truth.
Did you happen to see my review of Paul Davies' Cosmic Jackpot? link
Davies offered seven different versions (A through G).
My proprosed predetermined universe would be a combination of "B. The Unique Universe" and "F. The Self Explaining Universe".
My Ultimate Engineer (also Science Fair Project) proposal is "D. Intelligent Design".
Comment by Thought Provoker — July 1, 2007 @ 11:54 am
July 1st, 2007 at 2:26 pm
TP:
How can you possibly claim EAM is "the Truth" (big-t) about evolution, by definition, if consciousness and its operative attributes are merely artifacts of quantum mechanics? The top-down control functions of consciousness in maintaining biochemical and biophysical processes in the various organ systems is unconscious, yet even unconscious control processes governed by the mechanisms qualify to fall under the general heading of "consciousness." IOW, none of it is accidental, though some of it's habitual.
Blarney. Matter is matter, whether it's in a rock or a human. Most of the observable, measurable nature of matter is habit – the habit of matter to be in a following moment what it was in a past moment. The cumulative history of an elemental atom is an impetus toward the future of that atom, providing us with highly predictable states in everything apart from unstable isotopes. Unstable isotopes decay by means of quantum processes that seek stability despite the atom being inherently unstable.
…but… but… You're really going to hate this. Remember me telling you I got to take a class in genetics back in college lectured by Isaac Asimov? Which I took only because I was his biggest sci-fi fan and could get in based on my then-current classes? Do you recall WHY I was allowed to take that course, even though my major wasn't (strict) biology? …it was because I was current in crystallography. Which, when applied to technologies dealing with certain biological constructs (DNA, MTs, proteins, etc.), revealed something I thought very interesting indeed. Though it was mostly ignored by those I thought it should intrigue the most.
While quasicrystals weren't a big item until the 1980s, there were some hints of something 'more' going on from X-ray crystallography of biomolecules even back before the wayward '70s. We were seeing fractal-like patterning in the diffraction symmetries even then. Took awhile before it started to come together in the mainstream, but the implications were fairly clear to a few.
I made a crazy off-the-wall projection to a few of my classmates (most were still kids who were not working day-jobs that required the regular use of germanium-lithium photospectrometers, wouldn't have appreciated it). Oddly enough [shockingly, to me], my projection predicted the very same crazy findings Ilya Prigogine had produced from a completely different physical direction of approach (I call it the +1 approach, since his operator was time). And for which he won the Nobel Prize that year.
The shock was that the same prediction could apply to life from such oppositionally tangental angles of approach confirmed for me a situation that caused some hefty cognitive dissonance. Whoa! More really *is* going on!!!
…my approach wasn't related to non-equillibrium thermodynamics or time as a function of life and its delicate balancing act. It was related to the diffraction patterns in bio-crystallography that had no apparent 3D explanation, strongly suggesting the extension of these structures beyond 3 spatial dimensions. Later confirmed, of course. I wasn't there for that (walked away in '79), but it's pretty standard by now.
What I'm trying to tell you – because you seem open to it, not because it will convince other die-hard 3D materialists – is that if life's balancing act is merely a 3D projection of structures existing in 8 or more dimensions, we cannot scientifically or metaphysically limit reality to 3+1. And if indeed – as is strongly suggested by evidence – there are more than 3+1 dimensions operating causally and effectively in reality, we can say nothing whatsoever definitive of "soul" or "spirit" or "gods/God" or "higher selves" or any of that stuff. None of it is ruled out. Extra dimensions may well influence the quantum realm with impunity.
IOW, it may not be as 'automatic' as you'd like.
Check Section 5. here for diffraction patterns.
Comment by Joy — July 1, 2007 @ 2:26 pm
July 1st, 2007 at 2:54 pm
Joy wrote:
Joy,
What was "later confirmed" and is "standard by now" I know it wasn't "the extension of these structures beyond 3 spatial dimensions", because anyone who actually proved the existence of more than three spatial dimensions would have garnered headlines around the world and probably a Nobel.
Comment by keiths — July 1, 2007 @ 2:54 pm
July 1st, 2007 at 3:13 pm
keiths:
Ignorance is no excuse. You're obviously not familiar with the inverse Joy transform. You should try it some time when you need to make sense of a diffraction pattern. Guaranteed >3D structures.
Back to my Tibetan monastery now…
Comment by Raevmo — July 1, 2007 @ 3:13 pm
July 1st, 2007 at 3:43 pm
What's the Fourth Choice?
Comment by Rock — July 1, 2007 @ 3:43 pm
July 1st, 2007 at 3:54 pm
TP – You may of course ignore any and all references to n-D lattices necessary to translate 8, 10, 12-fold or more symmetries required to describe quasicrystals, as keiths and Raevmo insist you must. Since these two critics obviously know more about magic poof-dom than you or I will ever know, who am I to suggest they don't know sh*t?
I have no Tibetan monastery to retreat to, I've just got ripe blackberries on the knob, at the high field and down at the swimming hole that need pickin' before da bear gets 'em. So I'm organizing some small dogs and teenage boys for super-secret "Project Cobbler" (sssshhhh… if keiths and Raevmo hear of this they'll turn us in to DHS or CNN for sure!), zero hour this evening at around 7, complete with French Vanilla. It's an anti-global warming project, or maybe just a cure for hunger…
I can see that any contributions I might make to this thread will be immediately short-circuited by my obsessive anti-fans. So good luck with it. Without me, you might get more said with less distraction.
Comment by Joy — July 1, 2007 @ 3:54 pm
July 1st, 2007 at 4:23 pm
Hi Joy,
You wrote…
I understand, but please keep contributing.
I think we share an understanding of priorities. I just spent the afternoon on a very critical project that dwarfed anything Penrose et al have done. We needed to pick out the perfect bicycle for my five-year old granddaughter in order to deal with impossibilities of balance and coordination enabling her to traverse the complicated bike trails at the local park. It even involved a magic invention, training wheels.
It will be a day she and I will remember for the rest of our lives.
BTW, I love fresh blackberry cobbler with French Vanilla ice-cream. I hope that was an invitation. If it was, do you mind if I bring a very happy five-year old along too?
Comment by Thought Provoker — July 1, 2007 @ 4:23 pm
July 1st, 2007 at 4:34 pm
Hi Rock,
You wrote…
lol
I can empathize. Do you think I LIKE the implications of all of this?
Please, please come up with a better answer.
If all else fails, we can fall back on my teenage son's solution… Don't ask the stupid questions in the first place!
Comment by Thought Provoker — July 1, 2007 @ 4:34 pm
July 1st, 2007 at 5:13 pm
Raevmo wrote:
I think I'll try it on my clothes dryer, to see if I can get my lost socks back into "3+1".
Joy wrote:
No, just the ones in which you claim to have demonstrated the existence of extra spatial dimensions, or of a vast conspiracy to cover up the evidence of superconductivity in human bodies.
Comment by keiths — July 1, 2007 @ 5:13 pm
July 1st, 2007 at 5:16 pm
Hi Joy,
You wrote…
What is there to hate? I have gotten used to struggling with nearly impossible concepts that cause me headaches from all the synapses firing just to reach a point where you are comfortable with dropping the next breadcrumb for me to follow. So I can start the whole process over again until the next breadcrumb.
Believe it or not, I am grateful for your patience and efforts. I would like to think I am above average in solving riddles. You said something about me being quick on the uptake. I did pick up on your various hints about your past. There is a reason I use a anonymous pseudonym. You may be beyond caring what certain government and quasi-government agencies think of you, but I am not to that point yet.
I think I am getting to the point of understanding why Penrose doesn't like the various string theories, and I think I am getting a hint as to where the 8 dimensions come from (real and imaginary components of a single property is something I grok).
My turn to suggest you might be being a little impatient. I will get there. You don't have to worry about that. But, I can't zip through and understand Penrose's Road to Reality in a single sitting. I don't have enough background to do this.
I am already hooked. I am not going to stop now. However, I am taking a little detour. I want to drag a couple of other people along with me on this journey. It may be a fool's errand, but I got to try.
At some point we may want to revert to something a little less public. "Thought Provoker" has a hotmail account. He also has a blog nobody pays attention to. For now, I hope to stay on Telic Thoughts even if it means ignoring some unpleasant and ignorant comments.
Comment by Thought Provoker — July 1, 2007 @ 5:16 pm
July 1st, 2007 at 5:42 pm
Hi, Rock,
How about none of the above? To be fair, I would also include 'none of the above' to all materialistic philosophies. Of course, if you just want something to believe in that passes your smell test for common sense and which makes you feel smart and witty, well, you have your choices. If they all seem to suck for one reason or another, then try this:
1. While in the safety of your study, assume that any theory of matter that attempts to describe reality is false. There are no exceptions. It will be good if you are not interrupted by something or someone while assuming this.
2. Now say to yourself, "I think, therefore I am." From there, try to logically deduce why you think that, bearing in mind number 1.
Later, when you are in your car, or crossing the street, or are otherwise out and about, deal with what you perceive just like you always have. You should bear in mind, however, that while you are perceiving objects through your senses, you are not perceiving reality. That does not mean, however, that you still can't enjoy your sensibly perceived things, much like a child having a blast playing with his legos.
Comment by AnaxagorasRules — July 1, 2007 @ 5:42 pm
July 1st, 2007 at 6:20 pm
Hi Joy,
Time to get down to some arguing…
Ok, so I was attempting some appeasement to the OMA crowd and you caught me. I'm afraid I can't offer much of a good counter-argument since, if I understand what you are saying, I agree with you.
I said "A rock has little use for such a thing. It provides some value to quasicrystals."
You resonded with…
At the risk of sounding stupid, let me attempt an "Ah Ha"…
Most of us understand that we can get order out of chaos, but few see how chaos can come from order.
Quantum processes are predictable and ordered until interactions with things outside the quantum realm cause inherent paradoxes. These paradoxes in a ordered system results in chaos. Thus, chaos from order.
Ergo, a stable rock is no more "natural" than an unstable isotope. We rely on the "habits" of these objects because we have no other choice and historically it has worked for us.
Am I close?
This is a little bit preaching to the choir. Yes, I accept that there are more than 3+1 dimensions. I think these "extra dimensions" are real even if we call them "imaginary" components of complex properties.
As an electrical engineer I understand e ** jwt (we use j instead of i for the square-root of -1). To me, understanding implies reality. It is real to me.
[Looks around for Stunney in hopes he didn't hear this]
The link you provided was great. Here was something of interest concerning multiple dimensions…
I understand this to mean we have to assume nD-reciprocal space to make sense of quasicrystals.
It might weaken Penrose's non-algorithmic argument, but it strengthens the multidimensional argument.
I agree, one, or both, of these pragmatic beliefs have to be given up by the 3+1 materialist in order to explain the evidence.
Thank you for your thoughtful post.
Comment by Thought Provoker — July 1, 2007 @ 6:20 pm
July 1st, 2007 at 6:25 pm
Not to worry, TP. There are no governmental or quasi-governmentals I need to care about. That was worked out long ago, once they could no longer keep a lid on "The Void at the Center of the Core." Some of us are even still alive to thumb our noses in their direction from gated enclaves in the deep woods (where they like to stash inconvenient truths). You may have thought those Virginia Farm Boys were tough… they're nothin' to No'Cackalackie 'Shine-Runners! How do you think NASCAR got its start???!!!
That said, I am pleased to report that "Project Cobbler" was a complete success despite a couple of low fly-overs by black helicopters and one large C-5A that I suspect still belongs to an old friend of Franklin Graham's. No, they didn't drop medicine or teddy bears, which might have smushed thousands of low-leaning blackberries or even angered ursula da bear into attacking Imogene the Coyote-dog or Ultimately Loyal Lucille, who picks low-to-the-ground blackberries carefully with her lips (I kid you not). Usually she goes ahead and eats them herself, though…
That's two quarts of hard-earned berries mixed with a big tablespoon of blackstrap molasses, 1/3 cup of white sugar, 1/4 cup fruit brandy (advise blackberry but pear or peach works okay), 1 tbsp lemon juice and 1/4 cup flour. Spread evenly in a 9×12 cake pan and top with dough: 1 cup flour, 1/2 cup rolled oats, 4 tbsp cold butter cut in. Add 1 tbsp molasses, 1/3 cup sugar, 1/2 tsp baking soda, 1 tsp baking powder, 1/2 cup milk, and 1/2 tsp vanilla. Spoon the crust mix on top, try to spread semi-evenly with a fork (or not) and bake at 375º until crust is golden and berries are bubbly. Cool 20 minutes on the windowsill and serve topped with ice cream, provide fresh watermelon on the side to wash it down.
Goes well with barbeque chicken or rainbow trout (wrapped in fresh green sassafras leaves and slow-smoked in foil), whole celeriac roots with baby potatoes or Jerusalem 'chokes in foil with a side of flame-broiled mushroom-pepper-Vidalia-green tomato kabobs. Also works well with cajun boiled shrimp and crab (or crayfish if you've got kids you wish to keep really busy for a couple of days in the creek flipping rocks and collecting critters).
You and any kith/kin you care to expose to copperhead country are welcome! Lucille's a pretty good kid-herder as well as a trustworthy snake-dog. You just have to pay attention to what she's telling you. City kids don't do too well with that, in my experience.
Happy Independence Week!
Comment by Joy — July 1, 2007 @ 6:25 pm
July 1st, 2007 at 6:46 pm
Hi Joy and MikeGene,
For what it is worth, if I was moderating this thread I would hole these two comments.
Raevmo's comment
Keith's second comment.
I will respond to Keiths first comment.
If you hole the two comments, please delete this comment too.
Comment by Thought Provoker — July 1, 2007 @ 6:46 pm
July 1st, 2007 at 7:12 pm
Hi Keiths,
You wrote…
Did you know that neither Hawking nor Penrose has received the Nobel Prize for their work?
Black holes are "standard by now" and most people would say their existance has been confirmed. But this kind of physics is very close to metaphysics. It is hard to tell a thought model from reality.
Multidimensional theories are the same, if not worse.
Did you read the part of Joy's link where the author explained exactly what Joy was talking about? I have yet to catch Joy in an assertion that isn't shared by knowledgeable scientists (and I have looked). While she doesn't usually provide links to support what she knows, it is foolish to assume no such support exists.
Comment by Thought Provoker — July 1, 2007 @ 7:12 pm
July 1st, 2007 at 7:22 pm
Hi TP,
So we are continuing the "QM magical mystery tour". I've read over your model"¦ AGAIN; and there are a number of issues that continue to bother me. I guess the primary one focuses on retro-causality. What exactly do you think the you think appeal to retro-causality really explains? Does it explain the origin of the universe? The universes "fine-tuned-ness"? The origin of information? The origin of life? You claim that you have a mechanism, but what good is such a claim if it can't explain anything? My reading of Hameroff is that he only appealed to retro-causality to explain some of the short-term characteristics of conscious thought. Furthermore, if you have OR do you really need retro-causality? I would expect you would need retro-causality only in a world where you have only SR?
Comment by JOHN_A_DESIGNER — July 1, 2007 @ 7:22 pm
July 1st, 2007 at 7:51 pm
Mike:
Well, I suppose we could then argue about how "conscious" prokaryotes are. But since both cilia and flagella are MT structures, maybe the pertinent questions would be more related to whether or not prokaryotes are elder siblings or devo-mutants. Since that question currently looms large (long after they THOUGHT they'd answered it), perhaps we should withhold judgment at present.
Obviously, eukaryotes have employed MTs in a host of useful functions prokaryotes never thought of (or maybe forgot). That they can serve such nifty functions is rather a spectacular feat, I think. I'm not saying they're a be-all or end-all – their MAPs (including actin filaments) look to be much more specified, and multi-tasking as well. Still, it's an intriguing direction in which to seek mechanism. We do presume there must be mechanism, don't we?
Comment by Joy — July 1, 2007 @ 7:51 pm
July 1st, 2007 at 8:11 pm
John A.:
Retrocausality can, IMU, only apply to the moment-to-moment collapse of wavefunction, and then only in the minds of people who accept that reality is real. FAPP. In all geometries of spacetimes (however-dimensional) I've encountered in the strange world of mathematics, 'history' is considered to BE 'history', even when time is orthogonal. In quantum terms, this is considered to be the accumulation of past "irreversible" events, or – if you're not a multiverser with a bad case of Woo – T-H-E past. Recorded in reality somewhere, even if only a single probability's past-tense.
I honestly do not believe that the opinions of those who do not consider reality to be real need be a sticking point in anyone's examination of the real. IOW, they've made themselves irrelevant.
Retrocausality beyond moments is only necessary in models that don't count both history and habit as ongoing and recursive causal factors. I don't think modern man (or our future intelligently designed clone-kin) is the cause of the universe or its fine-tuned specificity or any gods/God that may or may not influence things here in 3+1 reality. Time may bend and warp most amazingly when relativistically factored into more than 3 spatial dimensions, but only if we don't factor it as a naturally orthogonal modifier to all of them. No matter how many of them there are.
We do not have a good handle on what – exactly – time *is*. Hardly anyone is bothering to ponder the question. Just as gravity was always and for everything a simple 'given' that didn't need definition until astrologers came along, time is that now. It's always been that, and Einstein's the only one who even bothered to try and reckon with it. His reckoning isn't clear enough for us to take further, so we're stuck right now.
Funny how one has to use time qualifiers to even attempt to describe the situation, isn't it? Then – now – in the future… it might all be the same thing.
Comment by Joy — July 1, 2007 @ 8:11 pm
July 1st, 2007 at 8:33 pm
To JOHN_A_DESIGNER,
You wrote…
I appreciate your continued interest in this. I am sorry this is a rehash for you. May I suggest you treat it as a continuation of a thread that got too long.
Is it that retrocausality can't explain "anything" or that it can't explain "everything"
Retrocausality can explain experimental results in GHZ states. Retrocausality can explain how professional tennis players aren't helpless observers of a tennis ball going too fast for them to react.
Retrocausality may also explain some of MikeGene's Front Loading evidence. However, I admit this is a weak stretch beyond what Penrose and Hameroff are willing to suggest at this time. There is some popular scientific support for stretching retrocausality across millennia and outside strict quantum effects (e.g. Paul Davies, magazine features, newspaper articles, etc). I consider it brainstorming material pending more supportive evidence.
For the listening audience, SR means "Subjective Reduction" which is what Penrose/Hameroff indicates is the assumption in the standard Copenhagen Interpretation of Quantum Mechanics (aka "waveform collapse").
With OR, you still need either non-locality or retrocausality to explain GHZ states (or both). Retrocausality isn't magical if casual paradoxes can be avoided. I argue that quantum effects can and do avoid paradoxes by enforcing consistency.
The purpose of this teleological universe is to be consistent, by design. The design could be the result of an Intelligent Designer or it could be the result of a pre-determined, unintelligent process. This Third Choice hypothesis doesn't need to delve into which of these metaphysical choices is the Truth.
Comment by Thought Provoker — July 1, 2007 @ 8:33 pm
July 1st, 2007 at 8:46 pm
This alone is enough to earn it a place in the rubber science trash bin.
Comment by Vladimir Krondan — July 1, 2007 @ 8:46 pm
July 1st, 2007 at 8:47 pm
Hi TP,
Good thread…thanks for putting in the time and effort to try to communicate a very difficult concept.
Now I know why I could never hit a fastball….somehow I missed out on the retrocausality lottery
Vivid
Comment by Vividbleau — July 1, 2007 @ 8:47 pm
July 1st, 2007 at 8:51 pm
Vlad:
Tell me… is it Godel's theorem(s) that bug you most, or the term "non-deterministic?" Would it help if we substituted the word "unpredictable?"
Comment by Joy — July 1, 2007 @ 8:51 pm
July 1st, 2007 at 9:27 pm
Hi Joy and others,
It is my impression that Penrose and Hameroff went a little bit futher on retrocausality than your comment implied (at least as I read it).
From Consciousness, neurobiology and quantum mechanics: The case for a connection…
[emphasis mine]
P.S. Upon rereading this, I am emboldened to suggest that Penrose/Hameroff does lend some support to unconscious Front Loading.
This one is a keeper…
"Nonconscious backward referral of quantum information/quanglement which modifies existing information in the brain (e.g. adding qualia to primary evoked potentials, influencing choices) would not violate causality because the effects are unobservable before they occur."
Comment by Thought Provoker — July 1, 2007 @ 9:27 pm
July 1st, 2007 at 9:46 pm
Hi Vladimir Krondan,
You wrote…
I look forward to hearing your reply to Joy's request.
I will add that this is a minor side issue of the Hypothesis. While I would be saddened by the loss of my NOMA wall, everything else would still stand.
It just isn't a key link in the Penrose/Hameroff model.
Comment by Thought Provoker — July 1, 2007 @ 9:46 pm
July 1st, 2007 at 9:47 pm
Hi Vividbleau,
You wrote…
Thank you for the compliment. I am glad you found it interesting.
Comment by Thought Provoker — July 1, 2007 @ 9:47 pm
July 1st, 2007 at 9:55 pm
Generally, when Godel's theorem is invoked in this kind of context (biology, physics, etc), the simplest and most appropriate responses are scorn, derision, and cries of not even wrong!!. A most useful book is Godel's Theorem: An Incomplete Guide to Its Use and Abuse by the great Torkel Franzen. Sadly, Franzen died not long ago, but you can peruse his Godel-related posts on usenet.
It would help if you left Godel out of it.
Comment by Vladimir Krondan — July 1, 2007 @ 9:55 pm
July 1st, 2007 at 10:10 pm
Joy wrote:
The definition I have heard about time is that 'it is that which keeps everything from happening all at once.'
Seriously, we can't define time or space or matter and energy for that matter (pardon pun) because we consider them to be ontologically basic. Why not consider consciousness and mind to be ontologically basic? Of course as a theist that is how I approach the problem. Mind, an eternally existing transcendent intelligence, is the fundamental starting point to explaining all reality; including of course the uniformity of natural causes that science studies.
Comment by JOHN_A_DESIGNER — July 1, 2007 @ 10:10 pm
July 1st, 2007 at 10:15 pm
TP:
Well, I'm not sure I buy it, TP. They're going to have to separate nonconscious processes from conscious ones first, and I'm not so sure they're different phenomena at all. I'm thinking levels here, organized by priority. (Why does that sound a lot like my Mac's filing system?)
Perhaps it's because my mind is supposedly "wired" differently from other people's minds (something I also don't buy, I just think I've reserved more of what came standard with the model), but qualia are for me not the same as qualia for 'normal' people. Who learned early in life to section off processing quadrants, thereby ignoring crossover frequencies. For some of my perceptions a neurologist doing a real-time MRI would swear by all that's holy (to neuroscience) that I'm completely unconscious. As in not awake, because of drastic anomalies in blood flow.
…but I wouldn't be unconscious, I'd just be processing overlapping qualia in some area of the brain they're not looking at. Because they believe with all their hearts and minds it MUST happen *here* (so they can quantify and control it). I'm a regular anarchist for cog-sci guys, for sure!
In 'normal' operations it doesn't seem so odd to me that conscious awareness would lag autonomous awareness (qualia, processing, reaction) by some measure. Haven't you ever started at some stimulus that was unexpected? Didn't it seem to take an eternal moment? Do you really expect your autonomous functions weren't trying like hell to categorize it reasonably before it fed you the startle response?
IOW, we rely heavily on autonomous functions of sensation and analysis. Or, our "higher" brain control center does. Maybe not so much in a modern city, but that's only because we've managed to autonomize modern city-stuff. We're quite handy that way.
When your brain feeds you an anomaly after all its pre-processing, do you tend to ignore it? Do you query your autonomous system to see if it erred? Re-analyze the situation from top-down? Do you assume it's a computational glitch, and ignore it? Do you ever send immediate "look sharp" (fight or flight) orders to the system just in case it's a real threat?
I don't think there's a real time anomaly here. I think it's just the 'normal' hierarchy of our control system and its sub-units. MOST of what we sense and react to on a moment-to-moment level is sub-conscious (a step above unconscious). This allows us control of our focused awareness function, which is very much top-down. We mostly use it automatically. What is she saying to me? What does it mean, and what does she want from me? How does that relate to X (that may have happened long ago)? Can I get laid if I play this right?
[The last is a nod to that 'other brain' the males of our species often use to think with.]
Lord knows our conscious awareness has plenty to keep it occupied at any given moment in time. Unconscious can become subconscious which can assert itself fully onto consciousness if it's needful enough. Sans such situations, the delay time will probably keep you from saying something stupid, thus get you laid before the night is out… §;o)
Comment by Joy — July 1, 2007 @ 10:15 pm
July 1st, 2007 at 10:20 pm
I wish I could wrap my mind around all these words. It's like trying to dry off a humpback whale with a sheet of Kleenex. While it's still submerged.
When I read the word "retrocausality", it looks like a way to inject intelligence into design, but doing it backwards, so that we created the universe. Or have created it. Or perhaps our future selves did. Or will do so.
What's that thumping? Oh, that's the artery ballooning in my cranium. Same as always.
Anyway, that concept – humans (or superhumans… or whatever) creating the universe so they can have a place to exist – reminds me of the U'wa people of Colombia. They say that the name they call themselves means "the thinking people", and they believe that they sing the world into existence every morning.
Of course, this sounds like so much superstitious nonsense, like some here have declared all theism to be. I wonder what the geologists working for Occidental Oil (Oxy) think about superstition now:
Just a bit of bad luck. Coincidence maybe. Like all of the other coincidences that superstitious people celebrate as non-coincidence. Except this particular one is costing a business – one that depends heavily on predictable science – several billion dollars.
Comment by angryoldfatman — July 1, 2007 @ 10:20 pm
July 1st, 2007 at 10:22 pm
TP:
I thought hitting tennis balls, baseballs etc. had been explained by physiologists as something known as reflexes.
Comment by JOHN_A_DESIGNER — July 1, 2007 @ 10:22 pm
July 1st, 2007 at 10:30 pm
Yeah, but that's not good enough. I bet you thought you could easily explain why your telephone book is incomplete too (no recipe for swedish cream puffs)… but now we know it's because of Godel's theorem and quantum whatever.
Comment by Vladimir Krondan — July 1, 2007 @ 10:30 pm
July 1st, 2007 at 11:08 pm
Hi Joy,
Hameroff wrote…
"Nonconscious backward referral of quantum information/quanglement which modifies existing information in the brain (e.g. adding qualia to primary evoked potentials, influencing choices) would not violate causality because the effects are unobservable before they occur."
You wrote…
I am bordering on ecstatic here. I was right!
I am not saying that you are wrong. It is just that I was right in my understanding of Penrose/Hameroff. I got worried when you seem to disagree with what I was saying. But it turns out I understood correctly, you just disagree with Penrose/Hameroff on this point.
I only wish I had the understanding to argue against the likes of Penrose and Hameroff. I am working at it. For now, I will be content with just being the messenger/editor of other people's ideas.
At this point, I believe the "Third Choice" hypothesis is coming close to fitting together as Penrose/Hameroff would have it.
Here is why I am biased towards Retrocausality…
1. Delayed Choice Quantum Eraser is compelling evidence for retrocausality.
2. Non-locality isn't better supported than retrocausality (GHZ forces either/or)
3. Non-locality probably causes retrocausality anyway (superluminal)
4. It explains MikeGene's Front Loading evidence
5. It is too easy for a telic universe to avoid casual paradoxes.
Now I still haven't come up to speed on the multidimensional aspect you are already comfortable with. But I don't think I am getting so far afield that I can't adjust the model as I learn more.
Comment by Thought Provoker — July 1, 2007 @ 11:08 pm
July 1st, 2007 at 11:34 pm
To JOHN_A_DESIGNER,
You wrote…
Are reflexes the result of our conscious will?
If not, then we are helpless observers watching our reflexes perform.
This doesn't seem to match what happens in activities like playing tennis.
Consciousness experiments like Libet put the time lag around a half a second.
That is too slow for playing tennis. I don't believe neurologists and/or psychologists have an answer.
The major critics against Penrose/Hameroff generally accuse them of employing Quantum-in-the-gap (similar to God-in-the-gap). Therefore, there is a recognized gap here, otherwise the critics would be using Occam's razor.
Comment by Thought Provoker — July 1, 2007 @ 11:34 pm
July 1st, 2007 at 11:41 pm
Hi angryoldfatman,
You wrote…
I empathize. I have had to endure a lot of headaches to pull this hypothesis together.
Comment by Thought Provoker — July 1, 2007 @ 11:41 pm
July 1st, 2007 at 11:51 pm
Hi Vladimir Krondan,
You wrote…
I think we all get the fact that you don't like Penrose's use of Kurt Gödel's incompleteness theorems. It is a minor side issue.
Presume Godel is left out.
Do you have any other constructive critisism?
Comment by Thought Provoker — July 1, 2007 @ 11:51 pm
July 2nd, 2007 at 1:08 am
Joy:
The fact that an N-dimensional model is the most economic way to describe some aspect of reality (such as quasi-periodic crystals) doesn't imply that space is N-dimensional. Observe any N variables that are not fully correlated and you can summarize the information in an N by N correlation matrix which has N orthogonal real eigenvectors.
I'm open to the idea that space has more dimensions than we can "see", but so far they haven't been "seen" in any reproducable way as far as I know, even if string theorists feel they need those extra dimensions to make their speculative models work.
Go ahead and throw this retrocausally in the hole if you like.
Comment by Raevmo — July 2, 2007 @ 1:08 am
July 2nd, 2007 at 1:40 am
Thought Provoker, in that previous thread, no, I did not mean 'qualia'. I meant what I typed, 'quanta'. Is this the right thread to pursue the discussion, starting, say, from this post, concerning retrocausality, gravitational energy, 'n' stuff?
Also, I think this quote from Stephen M. Barr, a theoretical particle physicist at the Bartol Research Institute of the University of Delaware and author of a very fine book published in 2003, Modern Physics and Ancient Faith, originally at this post seems quite relevant in several ways to this thread:
Comment by stunney — July 2, 2007 @ 1:40 am
July 2nd, 2007 at 10:05 am
Behe passingly (and not very directly) mentioned the third choice in one of his essays. See: True Acid Test, Reponse to Ken Miller
He cites a paper on Quantum Evolution in relation to Adaptive Mutagenesis. (the pre-cursor idea to Endogenous Adaptive Mutagenesis).
I now have McFadden's book, Quantum Evolution which is a retrocausal, non-Darwinian approach to evolution.
PS
I do think there is some retrocausality in evolution, definitely cosmological, and partially biological.
Nevertheless, I'm confident the YECs will have the best scientific model in the end.
Comment by Salvador T. Cordova — July 2, 2007 @ 10:05 am
July 2nd, 2007 at 10:23 am
Hi Stunney,
I have some errands to do after which I will get back to this. Meanwhile let me point this out (I said earlier)"¦
I would be interested in your reaction.
Comment by Thought Provoker — July 2, 2007 @ 10:23 am
July 2nd, 2007 at 10:55 am
Raevmo, to Joy:
It's ironic that Joy is confusing a mathematical space with real space, since it was she who did a post on the mapping of the Lie group E8, stating:
Comment by keiths — July 2, 2007 @ 10:55 am
July 2nd, 2007 at 11:13 am
TP wrote:
TP,
You've got it exactly backwards. Libet's gap is a problem for Hameroff, who wants to see consciousness as the initiator of willed actions. This forces Hameroff to invoke retrocausality to explain why the neural activity associated with a decision to act precedes the conscious awareness of that decision.
For folks like Wegner and Dennett, who see the conscious will as an after-the-fact reconstruction, Libet's gap presents no problem, and is in fact expected.
Comment by keiths — July 2, 2007 @ 11:13 am
July 2nd, 2007 at 11:43 am
Hi Keiths,
So professional tennis players ARE helpless spectators watching their bodies perform? (they are just fooling themselves with "after-the-fact reconstruction")
Comment by Thought Provoker — July 2, 2007 @ 11:43 am
July 2nd, 2007 at 12:18 pm
TP wrote:
I'm curious about what you are saying here. Please elaborate and give us a few more details. I'm still struggling to understand the true scope of your model.
Comment by JOHN_A_DESIGNER — July 2, 2007 @ 12:18 pm
July 2nd, 2007 at 12:31 pm
Hi, Thought Provoker,
What I take from this experiment is that the thoughts of the testee actually begins to express itself when the electrical activity begins, and that there is a time lag before the thought gets translated into thought-words. In other words, the thought-word (the conscious awareness of the thought) is not the thought. Instead, the thought is the activity. What is really being seen here, I think, is that it takes time for the thought to be expressed in language.
Comment by AnaxagorasRules — July 2, 2007 @ 12:31 pm
July 2nd, 2007 at 12:33 pm
Thought Provoker wrote:
Their will is real, and the brain is initiating their actions; it is the conscious perception of the will that lags behind and amounts to a reconstruction.
This is mind-boggling stuff, when you first encounter it. If you're interested, I recommend Wegner's book The Illusion of Conscious Will.
Comment by keiths — July 2, 2007 @ 12:33 pm
July 2nd, 2007 at 2:57 pm
To JOHN_A_DESIGNER,
I wrote…"Retrocausality may also explain some of MikeGene's Front Loading evidence. However, I admit this is a weak stretch beyond what Penrose and Hameroff are willing to suggest at this time."
You responded with…
Welcome to the club. I, too, am struggling to understand the true scope of this model.
I recoil somewhat at the notion of this being MY model. It is more of a compilation of other people's hard work that I am presenting.
Trust me, this isn't false humility. I am more than arrogant enough to attempt to reach beyond my grasp, but even I have my limits.
With that caveat in place, I will continue my role as the opinionated blogger offering his guesses as potential pearls of wisdom.
Looking at the big picture, it looks like we have only a select number of uncomfortable choices to embrace scientifically…
1. Retrocausality is real
2. Metaphysics is real (God or Multi-world)
3. We aren't smart enough to figure out decoherence, yet
A humble and patient person would naturally pick number 3. Since I am neither, I pick number 1. Number 2 is a scientific cop-out and, frankly, I am surprised by how many multi-world proponents there are that don't see that.
Retrocausaulity is no more magical than Newton's F = MA with the only difference being the possibility of casual paradox (note: both are pretty "magical", it is just that F=MA has been accepted). Retrocausaul quantum effects don't have a problem with casual paradoxes, because they can't happen under quantum theory.
For this, and many other reasons, I believe retrocausality is really real at least at the quantum level. Note quantum retrocausality isn't inherently limited to short times. Some photon experiments have extended the time delta to milliseconds. Some Bell inequality experiments have taken place over kilometers with reason to believe the same results would happen for distances measured in light years.
Therefore, retrocausality can happen over Millions, even Billions, of years.
In this universe, it appears that if something can happen it does.
As to the "scope of the model". I believe the scope is "limited" to the interactions of quantum effects that do not risk casual paradoxes but can extend over Billions of year.
And, yes, I am proposing this as a "humble" scientific hypothesis.
Comment by Thought Provoker — July 2, 2007 @ 2:57 pm
July 2nd, 2007 at 3:42 pm
Hi AnaxagorasRules.
You wrote…
I am not sure why you added the qualifier "in language". Because the same process is observed for thought expressed as motion.
I think everyone agrees that it takes time for thought to be expressed. The simple interpretation is that conscious thought takes time, period. How much time? Hundreds of milliseconds. Too much time to explain certain abilities and behaviors.
Keiths appears to be trying to spin this as a non-problem for those who need to invent theories (e.g. "after-the-fact reconstruction") to avoid embracing retrocausality. With retrocausality, the explanation is simple with no risk of casual paradoxes.
Comment by Thought Provoker — July 2, 2007 @ 3:42 pm
July 2nd, 2007 at 4:33 pm
TP wrote:
Well, then why not go all the way? Why not take the leap and just accept, as some have suggested, that retro-causality goes back to the very beginning"¦ the Big Bang?
Consider this quote by John Gribbin from his book, In Search of Schrodinger's Cat:
Of course, Gribben goes on in the next chapter to describe the Many Worlds Interpretation. This is the one that he indicates that he prefers.
So, what is your view?
Comment by JOHN_A_DESIGNER — July 2, 2007 @ 4:33 pm
July 2nd, 2007 at 4:53 pm
Hi Keiths,
I found this positive review of Wegner's The Illusion of Conscious Will
It seems that Wegner is suggesting that not only professional tennis players, but we all are helpless observers watching what our unconscious body is doing while believing in the illusion of conscious will.
I don't think you have to worry about MikeGene or Bradford throwing your comments into the void in this guest hosted thread. Therefore, please feel free to confirm or refute my understanding.
I will offer this as a help. I agree that Wegner's explaination is probably the only alternative to retrocausality that makes sense of the evidence. Wegner sees Libet's findings and concludes consious will acts too late to be in control of anything.
Let's do some math…
Tennis Court baseline to baseline = 78' ~ 24 meters
Speed of tennis ball = 120 mph ~ 54 meters/seconds
Tme to react AND swing the racket = 444 milliseconds
Doubles tennis should be a physical impossibility.
Table Tennis dimensions = 2.74 meters (4 meters between players)
Speed of ping pong ball = 50 mph ~ 22 meter/second
Tme to react AND move the paddle = 182 milliseconds
Here is a link to a table tennis match. Try watching it assuming conscious decisions take a half a second.
Comment by Thought Provoker — July 2, 2007 @ 4:53 pm
July 2nd, 2007 at 5:05 pm
Hi, Thought Provoker,
From the excerpt of that article, it isn't clear what was used to determine the occurence of the conscious thought. I assumed it was the testee's conscious awarness of the thought to move his finger. I think in words, or more accurately, my awareness of my thoughts is manifested to me in language. Without the language to sort things out internally, I cannot distinguish one thought from another. That's why I used the word language.
Rather than using the testee's conscious awareness as the reference point to base when the thought to move the finger occurs, I would use the start of the electrical activity for a particular finger move as the reference point for the thought.
I don't think this turns us into "helpless spectators". When I consider all that my mind/brain does, and has done since my birth, complex transformations of light into images, waves into sound, personal contact into touch, nasal inhalations into smell, oral ingestions into taste, doing all this constantly, automatically, and with me only being aware that it is being done, and not having any conscious idea of how it is being done so effortlessly and automatically, I am forced to believe that my mind knows much more than it makes me aware of. Extremely tantalizing to me is the thought that my mind might actually know what reality is. Perhaps, through introspection, that reality can become manifested and known. First, though, one must rid himself of all delusions, as they are a hindrance. Since I began my investigation, I have been shirking one delusion after another, that were once bedrock beliefs. I'm straying a little bit here, but back to the main point of my post, it just seems more accurate to me to take the start of the electrical activity as the beginning of the thought, and the conscious awarness to come after and not having any effect on that particular thought.
Comment by AnaxagorasRules — July 2, 2007 @ 5:05 pm
July 2nd, 2007 at 5:29 pm
Hi TP,
Interesting numbers. Seems to me the issue is not just conscious will but experience. Since consciousness is lagging behind the actions it would seem that for a long point there would come a time when the players wouldn't be able to experience their actions. I wonder if Wegner addresses this? It would be an interesting experiment to have a long drawn out video game with rapid reactions (faster than conscious experience) to see what happened to experience. If a lengthy time after the game was needed to "recall" the experience that would say something about conscious lag and memory.
Comment by Steve Petermann — July 2, 2007 @ 5:29 pm
July 2nd, 2007 at 5:31 pm
To JOHN_A_DESIGNER,
You asked…
Personally, it is one of multiple Truths I accept.
God could be the ultimate creator and the ultimate manipulator behind the quantum effects or this all could just be the universe forcing consistency with itself. These are metaphysical concepts, IMO.
Are you trying to provoke a NOMA fight?
I think the Many Worlds Interpretation is a metaphysical concept, not a scientific explanation.
Comment by Thought Provoker — July 2, 2007 @ 5:31 pm
July 2nd, 2007 at 6:43 pm
Hi AnaxagorasRules,
You wrote…
Here is a brainstorming idea of an experiment…
We set up a quantum apparatus that "randomly" lights either a green or a red light based on a quantum effect. We rig the chosen light to illuminate at a periodic rate or when triggered by Libet's "readiness" electrical activity of the test subject. The test subjects push a green or red button based on which light he/she sees with encouragement to do it as quickly as possible, even to the point of trying to anticipate which light will be lit.
Would you accept the possibility of retroscasual decision making, if the results of this experiment showed that Libet's "readiness" electrical activity preceded correct Red/Green responses at statistical significant level?
There isn't a possibility of a casual paradox because the Red/Green observation will occur before the perceived decision is made. The perceived decision is made 500 milliseconds after the readiness response
P.S. My son was curious enough to look up who Anaxagoras was. Does your interest in him have anything to do with his religious preferences?
Comment by Thought Provoker — July 2, 2007 @ 6:43 pm
July 2nd, 2007 at 10:43 pm
You said: "Penrose refers to Kurt Gödel's incompleteness theorems as mathimatical proof that somethings in nature can, forever, be non-deterministic (non-algorithmic). I like this part of Penrose's model. I call it a definable NOMA wall that will prevent us from ever knowing the Truth. " This seems more than a minor side issue. But let it pass.
Oh, very well, but if you mean the sort of criticism that will encourage you journey deeper in quantum-godelian nonsense, no. But the following may be construed as constructive criticism in a different sense.
You say "quantum weirdness is real" and that there is some kind of "real paradox" involved in the usual examples of entanglement, superposition, erasure, and so on. Now, (an here is the constructive criticism), all these things, every one of them, are already explained by quantum mechanics. They seem weird when taken in isolation, removed from their source and projected onto a world of bouncing billiard balls. But all these effects are consequenced of the following: the magnitude of quantum amplitudes do not add like so |f| + |g| but like so: |f + g|. And because f and g are complex numbers, the have a phase angle, and this phase angle is responsible for all the things you call quantum weirdness. This is the thing you should try to explain. In some cases the things which are supposedly weird are not even that weird. They are found to some extent in classical physics, e.g., entanglement, non-commuting observables.
Einstein put forth EPR as a challenge: if quantum mechanics is correct, you should see this supposedly absurd effect. Which you do. It follows from quantum mechanics. Effects like entaglement make no sense to someone who believes reality must be ping pong balls all the way down. The temptation is then to put forth ping pong ball explanantions for quantum effects. Einstein, being a monist, was also a ping-pong-ballist. Nature works like a clock, a machine, a bunch of bouncing balls, and so on. The god he referred to when he said "God does not play dice" is the monist god: the laws governing clockwork and ping-pong balls. It seems unlikely that there will ever be a ping-pong-reality explanation for |f + g|. And why should their be? There has never been a particle of evidence that nature works as a big wind-up toy, or as a collection of charged ping-pong balls, or as a deterministic machine, or a big computer program, or an algorithm, or a formal system, or any such thing. There is no need to appeal to Godel's theorem or even quantum mechanics to notice this.
Comment by Vladimir Krondan — July 2, 2007 @ 10:43 pm
July 2nd, 2007 at 10:55 pm
Hi All,
In order to potentially spark some more thinking on this subject, I went looking for negative arguments against Penrose/Hameroff. Here is a 2005 paper I found that is a serious critique. I suggest those who wish to counter this Third Choice hypothesis should read it. It might help in coming up with better arguments.
Meanwhile, Hameroff's response is rather informative. Here are some excerpts…
The "warm wet brain" is a common criticism but I think Hameroff handles it pretty well. The other common critique is to argue that microtubules are just unimportant structural supports, nothing more.
This film clip MikeGene provided all but proves the fallacy of that assumption.
BTW, historically biologists once thought that a certain tetranucleotide was only an unimportant structural support for cells. It turned out DNA had another function.
Comment by Thought Provoker — July 2, 2007 @ 10:55 pm
July 2nd, 2007 at 11:17 pm
Hi, Thought Provoker,
I don't know enough about retrocausality to get into the fine details. I don't know much about Hammeroff, but I know that Penrose's thinking is strongly influenced by Platonic ideas. I sympathize with that. In fact, I would not take issue with the sentiment that the mind is aware of the Platonic realm and is from birth onward. Automatically.
However, in regards to this test, if the readiness activity always precedes the perception, then this indicates to me that the perception is an after effect. If the assumption is that conscious will is what inititates action, then this Libet test does not bear that out.
Does Retrocausality assume conscious will as the prime initiator of everything?
I chose AnaxagorasRules because he was the presocratic philosopher/physicist that said Mind was the order behind the universe. Mind was a seperate entity. According to Diogenes, the opening of Anaxagoras's book (now lost) went like this: "All things were together, then Mind (Nous) came and set them in order."
Here are the actual surviving quotes from Anaxagoras which deals with Mind:
"The rest have a portion of everything, but Mind is something infinite and independent, and is mixed with no thing, but alone and by itself. If it were not by itself, but were mixed with any other thing, it would have a share of all things if it were mixed with any, for there is a portion of everything in everything, as I have said before. And things mixed in it would have prevented it from controlling anything as it can when alone and by itself. it is the finest and purest of all things, and has all judgment of everything and greatest power; and everything that has life, both greater and smaller, all these Mind controls; and it controlled the whole revolution, to make it revolve in the beginning. At first it began to revolve in a small part, but now it revolves over a larger field and will include a larger one still. And the things that are being mingled and those that are being separated off and divided, Mind determined them all. Mind set everything in order, what was to be, what was but is now, and all that now is and shall be, and this revolution in which the stars, sun, moon, air and fire that are being separated off. This revolution caused the separating off. The dense is separated from the rare, the hot from the cold, the bright from the dark, the dry from the wet. There are many portions of many things, and no one thing is completely separated or divided from another save Mind. "
Wherever Anaxagoras got these ideas, it is safe to say that it was not from the oracle at the temple of Delphi!
When I logged on the first time to make a comment, Anaxagoras seemed to be in consonance with the theme here. Although Anaxagoras is not considered an atomist, he taught something that was amazingly prescient. It was his teaching about everything being in everything. In other extant writings and quotes from later authors who had possession of his writings, Anaxagoras taught that everything was in everything, for how else could bread and water turn into flesh and bone and hair? And as it turned out, he was right about everything being in everything. Does not every element possess the commonality of electrons, protons, and neutrons? I feel that Anaxagoras must have struggled with the language of his day, in trying to explain what he really meant. As far as I'm concerned, he was one of the giants.
Comment by AnaxagorasRules — July 2, 2007 @ 11:17 pm
July 2nd, 2007 at 11:20 pm
TP, "Here is a link to a table tennis match. Try watching it assuming conscious decisions take a half a second."
All kind of bodily systems have been shown to accelerate during certain activities. How do we know that all conscious activities occur at the same rate? The experiments that show conscious will takes 500ms may not accurately reflect what is going on during these table tennis matches. Is there any definitive information in the subject?
BTW, those table tennis guys are a gas to watch. Thanks for the link.
Comment by kornbelt888 — July 2, 2007 @ 11:20 pm
July 2nd, 2007 at 11:32 pm
Hi Vladimir Krondan,
Thank you for your thoughtful comment.
You wrote…
As an engineer I am comfortable with complex numbers, and you are correct to point out that expecting magnitudes to add is inappropriate. However, that is why I used the GHZ states rather than the diffraction pattern as my example. GHZ states can't be explained away as simple phase cancellation. Some treasured assumption has to give. Either that or we plead ignorance either directly or indirectly via a metaphysical construct.
I am trying to explain it. Retrocausality back to entanglement offers that explanation. IMO, a retrocasual explanation is no more (and no less) magical than the classical explaination of F=MA.
This confuses me a little bit. I appeal to NOMA and Godel to say a complete explanation is "unlikely" (my position is stronger). You have shown distaste both of my appeals, yet you seem to agree with the practical ramifications.
While the complete explanation is "unlikely", I believe Penrose has a handle on the interface between quantum and macro effects (decoherence) with his OR model. The OR model is not ping-pong balls all the way down. It is more complicated than that and stops short of attempting to explain everything.
I appreciate your efforts in providing constructive critisms. I hope you find my response understandable if not reasonable.
Comment by Thought Provoker — July 2, 2007 @ 11:32 pm
July 3rd, 2007 at 12:19 pm
Hi AnaxagorasRules,
You wrote…
I think you have a pretty good grip on the issue since you are asking the right questions.
Here is a link to a discussion of Libet's and Wegner's interpretations….
After a lecture in Göteborg by the neuroscientist Benjamin Libet in 1993, the Göteborg-Post carried the headline, "˜Now it has been proven: we are all somewhat behind'. The paper was referring to Libet's celebrated discovery that the neural precursors of some voluntary actions occur before the conscious awareness of the decision to act. In a series of experiments in the 1980s, Libet showed that in an experimental situation in which subjects were asked to perform a simple voluntary action "“ raising a finger "“ these acts were preceded by a rise in electrical activity in the area of the brain responsible for the causation of action, called the "˜readiness potential' (RP). But the striking discovery is that while the RP is activated 550 msec before the action, the subject's awareness of their decision to act occurs only 150-200 msec before the action. The conclusion is drawn that the causes of our actions in our brains occur fractionally earlier than our conscious awareness of deciding to do them. Hence the frequent description of the result of Libet's experiments, that we are "˜living in the past'.
The experiments have since been replicated by a number of other researchers, such as Patrick Haggard at UCL. But their implications have been furiously debated by psychologists and philosophers. Some have claimed that Libet's results have implications for the debate about the freedom of the will. In The Illusion of Conscious Will (Cambridge: The MIT Press 2002), the psychologist Daniel Wegner argued that Libet's results show that the commonsense idea that we have free and rational control of our actions is false. Wegner's view is that what he calls "˜conscious will' is an illusion, a "˜loose end' like the action itself, caused by prior brain activity….
Libet disagrees with Wegner's interpretation of his results. Although he does think that they show that "˜the specific brain activities leading to a voluntary act begin before "¦ the person is aware that he intends to act', he also thinks that a person also has the freedom to "˜veto' this merely apparently free act, and claims that this has experimental support. Hence his conclusion is that "˜conscious free will does not initiate our freely voluntary acts. Instead it can control the outcome or actual performance of the act.' …
Libet writes "˜that in a voluntary act, the conscious will to act would appear before or at the start of the brain activities that lead to the act'. But although we can sometimes be conscious of the activity of our will, we need not be. Decisions can be made, intentions can be formed, without any reflective consciousness of them. Think of how many voluntary actions you perform each day; and think how few of them are preceded by the consciousness of any decision-making…
My oversimplified version…
Libet – Conscious decisions take 550ms with the last act being a possible "veto".
Wegner – Conscious decisions occur almost immediately but it takes 550ms for the illusion of will to manifest itself.
Both interpretations assume the readiness potential occurs after the triggering event that causes a decision. What if that isn't the case? This is where Hameroff comes in with retrocausality.
Libet apparently does not like to speculate out-loud without experimental results backing him up. Therefore, I do not know how he reacts to my table tennis queries.
Wegner would obviously suggest the players are playing semi-automatically with the illusion of will always occurring a half a second behind the action.
Hameroff obviously suggests Libet's 550ms is the result of orchestrated quantum OR that includes retrocasual effects.
The start of the decision making process can begin prior to the event initiating the decision making process because all alternatives start in quantum superposition that collapse into a single state in concert with the quantum collapses occurring elsewhere and elsewhen in the universe which includes the quantum effects in the mind of a ping pong opponent.
We are unaware of all of this because observation forces immediate quantum collapse. Peeking is inherently prohibited by a telic universe enforcing consistency (i.e. no casual paradoxes allowed).
P.S. Thank You for the information on Anaxagoras.
Comment by Thought Provoker — July 3, 2007 @ 12:19 pm
July 3rd, 2007 at 1:01 pm
Hi kornbelt888,
You wrote…
I believe there is. I understand mental states correlate of EEG "brainwaves". A human goes from unconscious (less than 4 hz) to the highest form of consciousness (up to 120 Hz). The normal highly alert human is around 40 Hz. If this is the equivalent of the processor speed of a computer, it is conceivable that that 550ms could vary based on the fundamental processor speed. An 80Hz EEG mind state might result in a 275ms consciousness lag. I think it would be an interesting experiment.
BTW, Hameroff uses a similar assumption to estimate the hypothetical consciousness state of a carrot or rutabaga. Instead of cycles per second, it is in the range of cycles per month (note: Hameroff highly doubts even this hypothetical situation).
I'm glad you liked it.
Comment by Thought Provoker — July 3, 2007 @ 1:01 pm
July 3rd, 2007 at 1:28 pm
TP wrote:
In my opinion NOMA approaches like yours are nothing more than what Dallas Willard calls "warmed over logical positivism." Logical positivism went out of style in the early 1950"s because it was demonstrated that it's foundational principle "˜the verification principle' was itself unverifiable. Since then the majority opinion among philosophers of science has been there is no clear way to logically demarcate the boundary between science and non-science. Ironically, many scientists, such as Miller and the late SJ Gould, no doubt, in part, for their disdain for philosophy, still cling to a discredited form of positivistic thinking. It's ironic because logical positivism was largely the creation philosophers– in particular the pre WWII group known as the "˜Vienna circle'.
For example, in his 1974 essay, "The Problem of Demarcation" Karl Popper wrote that "the transition between metaphysics and science is not a sharp one: what was a metaphysical idea yesterday can become a testable scientific theory tomorrow." (Popper Selections, p123) I think what Popper was saying is that because scientific knowledge is always expanding it is impossible to define any fixed boundary, because that boundary may be erased or may be moved by new discoveries. A good over view of Poppers work can be found @ (http://plato.stanford.edu/entr...)
Comment by JOHN_A_DESIGNER — July 3, 2007 @ 1:28 pm
July 3rd, 2007 at 2:47 pm
JOHN_A_DESIGNER wrote…
It doesn't bother me to be "out of style". In fact, it kind of reassures me that I am not falling victim to Group Think. As for NOMA being an illogically inconsistent stance. I have been over that many times with other people. My recent run-in with Vividbleau is typical. The inherent paradoxes of philosophical thought have been known and studied for millennia (i.e. 1950s thinking has no more significance than last year's fad, maybe less so). Each person deals with philosophical quandaries in their own way.
I am not saying the Many Worlds hypothesis is wrong. I am saying it is in the same category as a God hypothesis. Both are clearly metaphysical by today's understanding. I use NOMA to separate metaphysical from scientific. However, I also realize that NOMA is also a metaphysical hypothesis and my use of it is illogically inconsistent. But, at least, I am consistent about it.
Excuse me for pointing this out, but it is a little surprising that you bring this up since you haven't been a proponent of the Many Worlds Interpretation. Do I sense an any-ship-in-a-storm panic?
I see the choices coming down to"¦
1. Unidentifiable Intelligent Designer
2. Untestable Many World
3. A Third Choice "“ Retrocausality via testable quantum effects
Rock's reaction was to ask about a fourth choice.
Comment by Thought Provoker — July 3, 2007 @ 2:47 pm
July 3rd, 2007 at 3:01 pm
Hi, Thought Provoker,
The experimental support isn't explained here. It might be hard to come by when motor activity is what is being tested, especially given the results of the original Libet test and its independent verifications. But I think Wegner has jumped the shark in his interpretation.
About the tennis players. I'm not a tennis player, but I played a mean game of handball and raquetball. I have first hand experiences with playing on pure reflex. I can remember general situations of hitting the ball in reflexive volleys, giving no conscious thought to each specific hit, yet consciously thinking of a strategy to win the volley, like a conscious thought streaming abstractly along while purely reflexive actions were taking place just to stay alive.
It seems that Wegner embraces the idea the the brain is the prime mover of activity, and that we are "helpless spectators." I haven't read his book, but if he does make this claim in it, then the first logical question is to ask what is this 'we' he talks about? In other words, is he a born again materialist or just a quasi? The questioning process will then proceed in a direction that depends on his answer.
Libet, on the other hand, seems to find the idea repugnant that the brain is the prime mover. I sympathize with him. But he's made his own bed. I am simply not going to allow myself to be sliced and diced into discrete parts as if each part was a separate entity. I do this sort of separation in conversations all the time, because it is forced by the state of the language and by my own sensible perceptions. But in the privacy of my own thoughts, there is no separation. The 'I' in me is a pointer to the entire organism, from head to toe. The day I see a brain floating in a vat with electrical wires hooked up to a computer that is being controlled by that brain, well then I'll have to consider that the brain really is a separate, discrete entity, and that the brain is the prime mover of organisms that have brains. Until then, I'm going to continue to think that Mind subsumes the entire organism, including the brain, and has as one very small part of its capabilities a conscious awareness function. This is why the Libet test results don't alarm me.
I bought Penrose's "The Emporer's New Mind" the other day, and am looking forward to reading it once I can rearrange my study schedule.
Comment by AnaxagorasRules — July 3, 2007 @ 3:01 pm
July 3rd, 2007 at 3:36 pm
TP, "I believe there is. I understand mental states correlate of EEG "brainwaves".
When I was waking this morning, for some reason this topic came to mind and I thought about it for a while in a semi-awake state (I do a lot of creative work in this state.)
It seemed to become clear to me as I pondered my own experiences of rapid fire guitar playing, synchronized with other musicians, that there is a curious thing going on when I'm doing this that I never really thought about before. My will definitely guides the process at a more "macro" level, but the more "micro" particulars seem to be somewhat automatic or "intuitive." There is definitely some kind of dance going on. I am certainly not willing every single note into existence. No way I can think that fast in the normal sense of thinking. But neither is the process completely automated.
I imagine this is what the ping pong players are experiencing. The rapid reactions are learned and rehearsed (over and over again thru willful practice), and this learned reaction dances with the will towards a goal, and yet the will can kybosh the whole damn process at any moment, because the will is the ultimate overlord and presiding judge.
Don't we all experience that every day when we drive our cars around? There is a dance between the intuitive, learned, automated processes (of the generally unconscious nuts and bolts of driving a car) and the will that decides to go down this street, toward some willfully decided upon destination.
KB
Comment by kornbelt888 — July 3, 2007 @ 3:36 pm
July 3rd, 2007 at 3:36 pm
Compare these four events: a lightning strike, a thunderclap, a decision-quale, and a wine-quale. Why on earth assume that humans are equally competent judges of the time-of-occurrence for all four types of event? The first two are obviously objective events for which time-of-occurrence can be independently tested. The latter two are, equally obviously, subjective events for which time-of-occurrence cannot be independently tested. So why assume that humans' level of competence of temporal judgements regarding the latter will be just as high as for the former?
If I ask a man, did she turn to look at you before or after you noticed how lovely she was, I would not particularly assume his answer is almost certainly accurate, no matter how honestly given. And if I'm drinking a bottle of great wine and love how it tastes, there's no reason to assume that I will therefore have the ability to signal or otherwise report accurately the time of the onset of that quale at any subsequent time, let alone be able accurately to compare the time of its onset with the time of a dot's appearance on a screen at any subsequent time.
Since Libet's results crucially depend on the accuracy of such reports, we have to assume that accurate reporting extends to reports concerning our own internal mental events, such as decision-qualia or taste-qualia. But this is a highly dubious assumption. For let's say the time of any given purely internal conscious event E is really t, the time of a related brain event B is t+1, and the earliest time at which the subject would be able to place E as having occurred is t+2. Then the assumption falls to the ground; for if we are systematically inaccurate judges of when our own mental states occurred, then Libet's data will also be systematically inaccurate.
From the relevant wiki entry:
Comment by stunney — July 3, 2007 @ 3:36 pm
July 3rd, 2007 at 4:26 pm
Thought Provoker wrote:
Isn't that just the 2nd law of thermodynamics. Increasing entropy, arrow of time, why broken eggs don't unbreak, and all that jazz. I recently re-read the bits in Brian Greene's Fabric of the Cosmos dealing with it.
Talking of entropy, I wonder what your reaction is to Penrose's comments on the unbelievably ordered, i.e., incredibly low entropy state of the universe at the Big Bang, in The Road to Reality. The conditions of the Big Bang were, he calculates, precise to one part in 10 to the 10th power raised to the 123rd power, an unimaginably vast number. I noticed just now it's listed at the wikipedia list of unsolved problems in physics.
By the way, here's some more of Huw Price.
And by the way too, I take it you've seen this before?
Comment by stunney — July 3, 2007 @ 4:26 pm
July 3rd, 2007 at 8:42 pm
Hi AnaxagorasRules,
You wrote…
I would be interested in hearing what you think of it. I haven't read it myself. I am still struggling through Penrose's Road to Reality.
Comment by Thought Provoker — July 3, 2007 @ 8:42 pm
July 3rd, 2007 at 8:49 pm
Hi Stunney,
Thank you for your thoughtful comment
(if you keep this up, I might get the impression you are being respectful).
I hadn't thought of it in that light. I knew that some people have suggested entropy somehow dictates the flow of time.
I guess it is consistent with what I was saying about quantum order causing macro chaos. If Penrose's OR is shown to be correct, it could lead to a lot of puzzle pieces being put into place.
Joy, are you reading this?
If you are, would you comment on this aspect of time?
Thanks again Stunney.
Comment by Thought Provoker — July 3, 2007 @ 8:49 pm
July 4th, 2007 at 12:41 am
TP wrote:
My point wasn't that the verification principle (which IMO is the basis of NOMA) had gone out of style but why it had gone out of style: it was logically self refuting, or, stating it another way, there was no way to verify the method you were using to make verifications. Ironically you seem to have conceded this point. You said, "I use NOMA to separate metaphysical from scientific. However, I also realize that NOMA is also a metaphysical hypothesis and my use of it is illogically inconsistent. But, at least, I am consistent about it." In other words, you are consistent about being inconsistent?
Then you wrote:
Are you looking for converts? To be honest with you I'm growing more and more skeptical the more you describe your thinking. I think you are over reaching a lot, and bringing in topics that are really superfluous"”Godel's Theorem & NOMA, for example. However, what I'm really not buying is the whole idea of retro-causality, which seems to be so central to your whole argument. In fact, I'm kind of suspicious. I wonder if you do either. You are not trying to "Sokalize" us are you?
I'm not looking to science to give me a theory of everything. I derive meaning and purpose from somewhere else. Indeed, to look towards a scientific theory for meaning and purpose is to turn that theory into something metaphysical. Is that something you really want to do?
Comment by JOHN_A_DESIGNER — July 4, 2007 @ 12:41 am
July 4th, 2007 at 1:06 am
To JOHN_A_DESIGNER,
You wrote…
sokalize:To write or speak deliberate nonsense disguised as profundity by use of obfuscating academic jargon.
I think I will take that as a compliment. I tend to think I am weak on my "academic jargon".
I am not looking for people to follow me, so it doesn't matter if you think I am inconsistent of even insane. Look at the arguments, the evidence, and the links.
You started off making thoughtful counter arguments, but now it looks like you are trying to rationalize an excuse for disregarding this based on some side issue (e.g. NOMA).
Do you think I want to believe this stuff? Please, find the flaw. Explain how the Penrose/Hameroff model is incorrect and present a better model.
I want you to be skeptical, but poke holes in the logic not the messenger.
Killing the messenger won't invalidate the logic.
Comment by Thought Provoker — July 4, 2007 @ 1:06 am
July 4th, 2007 at 2:14 am
Thought Provoker, I would definitely recommend Greene's Fabric of the Cosmos on the general issue of entropy and the arrow of time, though it's not exclusively about that topic.
However, as for what you actually need to support your ideas, that article by Price could be very promising. Here is his conclusion, with added emphases:
This is what he means by 'a classical perspective': Teleology.
This is what he means by a 'habit of thought' that conflicts with time-symmetric quantum equations: No Teleology
He's making the case that we need to abandon the anti-teleological, time-asymmetric view of reality that has dominated The Scientific Worldview.
At pages 764-765 of Do You Know The Way To San Jose to San Jose? aka Road to Reality Penrose writes this:
Ok, at this point my incorrigible theism wanted to say, but Roger, you've just erected a false dichotomy! You've said that either God has to pick one initial state of the universe out of gazillions, requiring Him to act with practically infinite precision. Or, there has to be a scientific law that determines the initial state of the universe. But why can't God SIMPLY SELECT THE LAW? After all, if you, Roger Penrose, or any human scientist can discover that law using mathematical reason and even write an 1100 page book about the road that will lead us there; in other words, if you can use your mind to figure out what the law is—"“what the law, with mathematical necessity, must be or would be the obvious choice given an intention to create embodied creatures capable of grasping reason and value "”then why can't the law, whatever it is, be inherent in God's mind? Indeed where else would such a law be or exist, except in the mind of the Divine Mathematician? Penrose has fallen into the trap of thinking that God's selection of the Big Bang's initial state would be like God picking out one straw out of a barrel of untold quintillions of straws, and having to get it just right, or else we wouldn't exist. But suppose God has only to select one law from, say, five mathematically possible laws? If some future Penrose, Hawking & Co can figure out which law it is, then, great intellectual achievement though that would be, it would be a Jackanory game for God.
And guess what? It seems Huw Price agrees with me. In the article, The Role of History in Microphysics, he writes:
Anyway. On the related matter of the 2nd law of thermodynamics, it is one of only several arrows in Time's quiver:
Well, tempus fugit, as the ancient Romans used to cuss.
Comment by stunney — July 4, 2007 @ 2:14 am
July 4th, 2007 at 10:44 am
Hi Stunney,
You wrote…
He, she, it and/or they can.
When I invoke NOMA and indicate that I don't know unknowable Truths. I am "…simply reinforcing the argument that it is indeed misconceived to seek reasons of [this] nature."
Which is what Penrose said at the start of the paragraph you quoted from on page 764 of Road to Reality.
I suggest Penrose didn't spend 8 years writing a book to persuade, He wrote it to inform. To inform a public that soon will be very interested in understanding new insights into reality.
Whether intentional or not, it will also be a handy to have around when people start suggesting Penrose's OR model was just a lucky guesses.
Comment by Thought Provoker — July 4, 2007 @ 10:44 am
July 4th, 2007 at 2:58 pm
My 4th of July gift to you all. A thought-provoking riddle.
Assuming the validity of Einstein's Theory of Relativity which includes the idea that space-time is a four dimensional reality based on the observer's frame of reference…
Using a frame of reference of an astronomer looking through a telescope at Alpha Centauri (4.35 light-years away)…
How much time elapsed between the light wave's creation and observation?
Comment by Thought Provoker — July 4, 2007 @ 2:58 pm
July 4th, 2007 at 4:02 pm
TP:
Since I'm breaking after finishing 5 over on the last round (despite handicap, and 'old-person' extra do-overs), I'll answer…
No time at all, darlin'! Photons do not experience time. Unless they're interacting, that is.
Comment by Joy — July 4, 2007 @ 4:02 pm
July 4th, 2007 at 4:38 pm
Hi Joy,
You correctly answered…
Thank you for responding. Of course you have probably just intimidated the rest of the class.
I just finished my first pass through Penrose's Road to Reality.
It is finally getting through my thick skull the extent of the implications when Penrose insists that QM Theory must to be consistent with Einstein's Theory.
Combining Quantum Mechanics with Einstein leaves no choice but to recognize that the universe is a completely integrated many-particle state space.
Now, I understand why Penrose's critics won't even accept the first step and refuse to consider that gravity has anything to do with quantum effects. Watch out for the first step, it's a doozy.
I will write a follow up comment. If you would be so kind, please critique it. I would like someone to question my understanding.
Comment by Thought Provoker — July 4, 2007 @ 4:38 pm
July 4th, 2007 at 6:43 pm
Hi All,
In the opening post I used the term "retrocausality" because I couldn't think of a better term.
Having finished my first pass through Road to Reality I am heartened that Penrose, too, had trouble with verbalizing this concept.
He made multiple references to "redictive" (backwards predictive) and "quanglement".
Penrose explains on page 603 of Road to Reality…
Quanglement is quantum information. Quanglement has no restriction concerning timetravel since it can't create casual paradoxes.
This is consistent with what I was thinking.
Here was something new that clicked for me. As an engineer, I am comfortable with a Fourier Transformations. For those less comfortable, think of a audio graphic equalizer
Each bar represents a frequency. Mathematically, this is done through a complicated function that assumes periodic waves extending from minus infinity to plus infinity. A Fourier Transform can transform time-domain into a frequency-domain and visa versa. A single bar in the frequency domain corresponds to a pure sine wave in the time domain.
Since Fourier Transforms are reciprocal, a single bar in the time domain corresponds to a pure sine wave in the frequency domain.
If you think about it, this suggests a choice. Either knowing the instantaneous magnitude at a point in time or knowing the waveform for all time but not both.
Sound familiar? It is the wave/particle duality. This is what is going on in quantum mechanics. (see page 523, Road to Reality)
Another interesting connection that occurred half-way through the book (page 580). In discussing quantum entanglement and the difficulty in dealing with Einstein's relativity, Penrose wrote…
While the implications of this are significant on its face, this is only the start. Penrose goes on to explain how this results in infinities raised by POWERS of infinities. He emphasizes this with a "toy universe" with only 10 possible locations (as opposed infinity cubed) with only four particles (as opposed to infinity) results in a waveform with 10000 states.
The point being that this goes to show how much extra information there is in the universe. From page 582…
I thought this might be interesting to ID proponents focused on information origin and transfer. This universe is extremely information rich (telic?) just through its existence.
As I implied earlier, this all falls out of the first step, Penrose's "minor" adjustment of the quantum theory to include relativity.
Comment by Thought Provoker — July 4, 2007 @ 6:43 pm
July 4th, 2007 at 6:52 pm
Not to worry, TP. You know I'll critique, somewhat gently if you're still going in the right direction. Time's odd man out, and you seem to have apprehended that. All the 'extra' dimensions added mathematically ignore time altogether. As if it's not an issue. Duh…
Go ahead and get stuck on gravity. It's a good thing to get stuck on. But don't fool yourself into believing it's the only thing that's stick-able. Not-Time has been a considerable issue since Prigogiene. Actually, it was an issue long before he came along….
PS: We won the Capture the Flag games this year, didn't encounter a bear or have to jump a train. Sometimes that does happen…
Comment by Joy — July 4, 2007 @ 6:52 pm
July 4th, 2007 at 7:35 pm
TP:
Aw, come on! All the real action's at 60 and 120. Everybody knows that.
There's nothing "pure" here, grasshopper.
FAPP (for life), it doesn't much matter. Here there's no such thing as "instantaneous" or "all time." Really. We just do the best we can.
It's what we SEE of what's going on. There is probably some stuff occurring that we don't see. That's what FAPP is for.
Oh, honey. It's much worse than that. It's taken millions of pages of calculations and observations to even begin to deal with a single 3-body system we can take a look at every day of our lives. Earth-Moon-Sun. How many bodies are in your body? In mine? They can't even get close. It's not hurtful to understand that – things are way more complexified than you can ever deal with mathematically.
We are born to synthesize, TP. What we synthesize out of the ether of what's available is unique to ourselves. It overlaps quite a bit. It never really synchs.
What Penrose alludes to a lot but doesn't specify is us. We're the Jokers in the deck. He follows his father in this, something I respect a lot actually. They both aimed high. They're still closer than anybody else.
Comment by Joy — July 4, 2007 @ 7:35 pm
July 4th, 2007 at 8:23 pm
Uh… here's the totality -
Comment by Joy — July 4, 2007 @ 8:23 pm
July 4th, 2007 at 8:40 pm
Hi Joy,
Dare I ask?
Is that your prose?
(either way, I like it).
P.S. Thank you for the critique of my Road to Reality comments. I will probably be ready for the 8 dimensional space after I try to get a better grasp on Penrose's Twistor Theory.
Comment by Thought Provoker — July 4, 2007 @ 8:40 pm
July 4th, 2007 at 10:09 pm
TP asked:
Joy answered:
TP commented:
TP,
I doubt that, since she gave you the wrong answer.
You asked about the elapsed time from an earthbound astronomer's perspective. It's 4.35 years, because the light had to travel a distance of 4.35 light-years. Relativistic effects are minimal, because Alpha Centauri's radial velocity is only about a dozen miles per second.
Comment by keiths — July 4, 2007 @ 10:09 pm
July 4th, 2007 at 10:17 pm
Hi Keiths,
In the Einstein's space-time continuum, there are four axes with the observer sitting at T=0, X=0, Y=0, Z=0. The observer's light-cone (aka null cone) describes the T=0 axis in space-time. The light-wave at Alpha Centauri originated at coordinate T=0, X=4.35 Light Years, Y=0, Z=0 and was seen at T=0, X=0, Y=0 and Z=0. The delta T was zero in space-time.
P.S. Penrose described it on pages 405 and 406 of Road to Reality as Euclidean three space slices (with each slice being absolute time) versus Minkowski Space (four dimensional, both space and time are relative).
BTW, I may have stated the terminology wrong and I have the advantage of reading directly from the book. So don't take it personally.
Comment by Thought Provoker — July 4, 2007 @ 10:17 pm
July 4th, 2007 at 10:50 pm
Hi All,
I am glad Keiths responded (thank you Keiths) because it might help others understand why quantum mechanics isn't weird if you look at it using the appropriate frame of reference.
Ironically, from the quanta frame of reference, quantum theory is beautifully consistent and it is the macro world that is weird and messes everything up.
As Joy pointed out, a photon experiences no time. A photon is everywhere all at once. From the photon wave point of reference, there are no EPR/GHZ paradoxes. The waveform collapses (due to macro weirdness) wherever the observation takes place.
The fact that is looks like retrocausality to us is our problem, not the photon's.
Comment by Thought Provoker — July 4, 2007 @ 10:50 pm
July 4th, 2007 at 11:12 pm
TP,
Here are a few different ways of seeing that the correct answer is really 4.35 years:
1. At low relative velocities and in weak gravitational fields, the difference between relativistic mechanics and Newtonian mechanics is negligible. If light takes 4.35 years to reach us from Alpha Centauri under a Newtonian scheme, and if gravitational fields and relative velocity are small enough (and they are), then light will take 4.35 years to reach us under a relativistic scheme.
2. Light cones are divided into halves: a future cone and a past cone. Future and past would make no sense if T remained at zero along the axis of the light cone.
3. A light cone is a surface, not a solid. T stays at zero for a photon because the photon traces out a path on the surface. T does not remain at zero for the earth, whose world line forms the axis of the light cone, or for any other object whose world line lies inside the light cone.
Comment by keiths — July 4, 2007 @ 11:12 pm
July 4th, 2007 at 11:40 pm
Hi Keith,
Thank you for responding…
You are describing separate Euclidean three space slices with the assumption of absolute time for each slice. It is common to think this way. However, it is just a mathematical model. Is the speed of light reality or just an artifact of this mathematical model?
Terminology is always a problem in discussions like these. Our terminology reinforces common views created by terminology. Sometimes new terminology helps. Like calling them null cones.
In time + one dimension T=0 would be a line
In time + two dimensions T=0 would be a surface
In time + three dimensions T=0 would be a volume
The null cone is actually a volume, but it is hard to show that on a sheet of paper.
T=0 is a volume for Euclidean three space too. The volume in Minkowski Space is consistent with General Relativity and there is no artificial speed of light.
P.S. Minkowski Space works at non-relativistic speeds too. Minkowski Space and Euclidean three space are almost identical for short distances.
Comment by Thought Provoker — July 4, 2007 @ 11:40 pm
July 5th, 2007 at 5:34 am
TP,
Here's another way to understand the source of your error.
You wrote:
But I'm not. There is no such thing as absolute time in relativity theory, which is why this part of your previous comment makes no sense:
X, Y, Z, and T must all be specified with respect to a particular reference frame. If that reference frame is the earth, then the light wave originated at
T = -4.35 years
X = -4.35 light-years
Y = 0
Z = 0
and ended at
T = 0
X = 0
Y = 0
Z = 0.
ΔT = 4.35 years.
In the photon's reference frame we use a different set of coordinates (X', Y', Z', and T'). For the photon, T' at Alpha Centauri = T' at Earth = 0. ΔT' = 0.
In other words, time stands still for the photon during its journey from Alpha Centauri to Earth, but time continues to flow on Earth as the photon flies through space.
The fact that the speed of light is constant, regardless of the motion of source and receiver, is empirical and does not depend on relativistic mathematical models. The Michelson-Morley experiment was performed before Einstein published his special relativity paper.
You had already indicated that you knew that light cones and null cones were different names for the same concept:
True. My comments refer to the 2D plus time scenario, which besides being easier to visualize is the one which is usually illustrated in physics books.
Comment by keiths — July 5, 2007 @ 5:34 am
July 5th, 2007 at 9:01 am
Hi Keiths,
Page 405 from Road to Reality…
I will tell you what. I will skip ahead to the twin's paradox (we would have gotten there eventually) and then back off.
Penrose spent the first third of his book explaining mathematical modeling so the reader could reach "the stage of sophistication" to be comfortable in seeing things in entirely different frames of references. These frames of references included showing how infinities could be captured in a circle. One of the features of these frames of references is that they have different mathematical laws than we are used to in the commonly understood Euclidean three space. For example, given a triangle ABC, it is "obvious" that the addition of sides AB and BC must be greater than or equal to side AC. In Minkowskian geometry, the opposite is true for the time dimension.
From page 420, "AB + BC <= AC". In non-relavistic timeframes AB+BC equals AC FAPP.
On pages 420 and 421, Penrose addresses the "Clock Paradox" (also known as the "Twin Paradox"). Twins born on earth. One boards a space ship, and travels at relavistic speeds and returns to find that his brother is older than him.
The paradox in Euclidean geometry is that it shouldn't matter which twin you consider at rest, but it does. In Minkowskian geometry, there is no paradox. It falls out trivially.
However, as I said, I will back off. Terminology is difficult and I am going to have trouble boiling down a significant portion of a 1100 page book into a few comments. So I will just be satisfied with the recognition that photons travel in zero time.
From the photon's frame of reference, it thinks it is everywhere at once. Why should we insist the photon's frame of reference isn't valid?
Comment by Thought Provoker — July 5, 2007 @ 9:01 am
July 5th, 2007 at 10:16 am
TP asks:
Who said it wasn't?
Your question was:
You asked us to answer this question from the frame of reference of an earthbound astronomer. I did. The answer, as I've explained, is 4.35 years.
Nothing about my answer suggests that the photon's frame of reference is invalid.
Remember, TP, the cornerstone of special relativity is that the speed of light is the same in all reference frames: one light-year per year.
Let's look at distance, time, and speed of light from the point of view of four "observers": 1) someone at Alpha Centauri; 2) someone in a spaceship hurtling from Alpha Centauri toward Earth at one-half the speed of light; 3) an earthbound astronomer; and 4) a photon traveling from Alpha Centauri to Earth:
Observer: Someone at Alpha Centauri
Distance from AC to Earth: 4.35 light-years
Time for light to cover this distance: 4.35 years
Speed of light: One light-year per year
Observer: Someone on a spaceship traveling from AC to Earth at one-half the speed of light.
Distance from AC to Earth: 3.75 light-years
Time for light to cover this distance: 3.75 years
Speed of light: One light-year per year
Observer: Earthbound astronomer
Distance from AC to Earth: 4.35 light-years
Time for light to cover this distance: 4.35 years
Speed of light: One light-year per year
"Observer": Photon traveling from AC to Earth
Distance from AC to Earth: 0 light-years
Time for light to cover this distance: 0 years
Speed of light: One light-year per year
Note that the speed of light is the same in all four cases.
Also note that all four reference frames are equally valid.
Comment by keiths — July 5, 2007 @ 10:16 am
July 5th, 2007 at 12:36 pm
TP:
Since the discussion has moved now towards the subject t of information I Thought the following question might pertinent.
How does the OR-ORCH model explain how information got into the worlds original life forms? Or does it? IOW where does information come from? Consider the following string which represents strand of RNA: (the letters C, G, A & U represent the molecules four nucleotides)
CAAGUAGGGAGUUGAUAAGGGAUAUAAUCACAAGUAGUACAAGUAUCAGG
GUCUAAAACUGGGAGUUGAUAAGGGUCUGCAAUUAGA
As ID proponents and others (Polanyi, Davies and Yockey etc)have pointed out there is no way to reductionistically or deterministically explain the coded sequence in the above strand because there is nothing intrinsic in either the RNA or DNA nucleotides (DNA uses thymine (T) rather than uricil (U)) that would force them to create any functionally meaningful order. Indeed if there was something intrinsic to the nucleotides which did determine the sequence there would be no coding or ability to encode. At best you would have some sort of repetitive sequence like the kind you find in crystals. Sometimes this is referred to the sequence problem.
Comment by JOHN_A_DESIGNER — July 5, 2007 @ 12:36 pm
July 5th, 2007 at 12:53 pm
Hi Keiths,
If you need me to admit that my question was incorrectly worded, ok, I admit it. Your answer was probably correct for how I phrased the question. Please, excuse me for my unfairness.
Fortunately, Joy understood what I was trying to get at and answered a different question. I suspect that is why she phrased her answer as she did.
Looking at the problem using Minkowskian geometry for General Relativity helps provide understanding as to why quantum mechanics works the way it does. It helps resolve paradoxes (e.g. EPR Paradox).
Penrose is attempting to merge General Relativity (as opposed to Special Relativity) with Quantum Theory.
From Wikipedia's entry on General Relativity…
[Emphasis is mine]
My point of all of this is to provoke thinking on how quantum effects aren't the source of the appearance of weirdness, it is our stuck-in-the-mud insistence on FAPP Euclidean three space thinking that is the cause.
For all practical purposes the ground doesn't move, the sun travels overhead and the twinkling lights in the night sky are shining at the same time we see them.
From that point on we are relying on mathematical models to make sense of the abnormalities we come across. We continue to modify our mathematical models as more information is discovered. Minkowski's curved Lorentzian manifold is a precursor to Penrose's Twistor model which attempts to explain the "abnormalities" (things contrary to our FAPP thinking) found in both quantum mechanics and general relativity.
The implications of this model are rather disturbing, but the alternative is to try to ignore the hard problems or use metaphysical constructs to wish them away (e.g. Many World interpretation).
The danger in using metaphysical constructs is that anyone's "Truth" can be as valid as anyone else's. "God works in mysterious ways" is as good as having faith in undetectable alternate realities as an explanation for reality.
Penrose offers a scientific model that pushes metaphysical Truth a little bit deeper into the fundamentals of what makes reality real. It is how the game of science is played when one follows the rules.
I happen to think the Penrose/Hamerof Orch OR model provides a handy mechanistic model for ID advocates. It also provides naturalist (not supernatural) explanations for a lot of coincidences in living matter.
It is a good Third Choice and should be given serious consideration by anyone interested in following the scientific evidence no matter where it leads, IMO.
Comment by Thought Provoker — July 5, 2007 @ 12:53 pm
July 5th, 2007 at 1:05 pm
TP writes:
TP, you make a number of good points. However, John_A_Designer also pointed out what is IMO the core problem behind current models attempting to explain natural history,
John wrote:
If the Penrose/Hamerof Orch OR model could explain functional sequencing it would be a breakthrough. If it does but I'm not understanding how then an explanation would be appreciated.
Comment by Bradford — July 5, 2007 @ 1:05 pm
July 5th, 2007 at 1:10 pm
To JOHN_A_DESIGNER,
Excuse me if this sounds disrespectful, it wasn't my intent. Unfortunately I have to get back to work. I will try to give a more detailed response later.
Comment by Thought Provoker — July 5, 2007 @ 1:10 pm
July 5th, 2007 at 1:19 pm
TP wrote:
John, remind TP that the cup, he was referring to, had coded instructions in it.
Comment by Bradford — July 5, 2007 @ 1:19 pm
July 5th, 2007 at 4:11 pm
keiths:
The specific question was: Using a frame of reference of an astronomer looking through a telescope at Alpha Centauri (4.35 light-years away)"¦
How much time elapsed between the light wave's creation and observation?
The astronomer may 'know' from his training that the light is 4.35 years old (a symbolic designation on a notebook from triangulating a parallax), but he doesn't observe the age and he doesn't experience the time. Neither does the photon. For both astronomer and photon, the measurement occurs 'now'.
IOW, intellectually 'knowing' the light has traveled 4.35 light years is entirely irrelevant to the astronomer's measurement as well as to the photon he's measuring. The only time that elapses is a product of somebody's mind.
Comment by Joy — July 5, 2007 @ 4:11 pm
July 5th, 2007 at 4:13 pm
John A. Designer wrote:
John, this is not the right question to ask. The right question is: where does coded information come from?
Information per se is a fundamental feature of all reality. Hence information doesn't 'come from' something non-informational. Nor is information reducible to its material medium. The person that is me can be conceived of as 'information'. Now, of course, I am bodily, and this information is instantiated in a material or physical medium. But that medium (living human body-matter) is itself an instance of information. And the medium of that information, mediated in living human body-matter, may be viewed as energy. And the material medium of the information that we call energy is, at that level perhaps strings, or some other packet of information (describable by the mathematics of Lie groups, say). But no matter how far down you go, information is ineliminable and irreducible to the medium which embodies it. There just ain't no pure informationless matter, or informationless energy, or informationless stuff. But of course, something has to be ontologically basic. Trouble is, if one thinks of matter, or the 'medium' of information, as basic, then one arrives at a notion of an ontologically ultimate reality which is formless, informationless stuff. And that is not a coherent notion.
I conclude that materialism is ultimately incoherent. Either it ends up with formless, informationless stuff which, precisely because it's formless/informationless, is radically unintelligible, and therefore not a possible object of a rational judgement affirming its real existence. Or it has to smuggle in something else whose nature is not actually material stuff, such as a 'law', or a 'program', or an 'equation'. or 'organization', or 'function', or 'pattern', or 'configuration'–"”all of which ultimately depend on the irreducible reality of mind for their complete, coherent analysis, and their existence. Hence, information is irreducible to non-information.
So, the physical world consists of embodied packets of intelligible information, described by the wavefunction of the universe.
Comment by stunney — July 5, 2007 @ 4:13 pm
July 5th, 2007 at 4:41 pm
TP:
Naw, that's a bit of nifty a cappella from Todd Rundgren (Initiation, 1975). That one had another piece I've always liked, Fair Warning:
You know, wishing won't make it so
Hoping won't do it, praying won't do it
Religion won't do it, philosophy won't do it
The supreme court won't do it,
The president and the congress won't do it
The UN won't do it, the h-bomb won't do it,
The sun and the moon won't do it
And God won't do it,
And I certainly won't do it
That leaves you. You'll have to do it.
Weird taste in music, I admit. Then there's FiresignTheatre's late '60s/early '70s stuff. That's not music at all, but provided some cool secret codes for boomer-jockeys once upon a cold, cold war… §;o)
Comment by Joy — July 5, 2007 @ 4:41 pm
July 5th, 2007 at 5:22 pm
Hi All,
This thread has made for some interesting nuanced interplay between various positions. I like it, keep it up!
If Stunney isn't careful, he is going to start sounding like he agrees with me.
However, there have been some direct questions asked that I would like to address. First of all, what Penrose was trying to explain with his Toy Universe example is that when you interconnect all quantum effects to each other the amount of information is beyond unfathomable. Which is what Joy was talking about when she said… "…things are way more complexified than you can ever deal with mathematically."
Dembski's 10^120 Universal Probability Bound becomes a infinitesimal drop in the bucket for an interconnected universe. With this much information, the universe might as well be considered telic.
But, as salesmen like to say, there is more!
Regardless of whether or not you agree with Penrose's application of Kurt Gödel's incompleteness theorems it is extremely likely that Objective Reduction is both non-deterministic and NON-RANDOM. That, ladies and gentleman can be the portal to the source of your CODED information.
I still consider it a side issue for the Orch OR model, but it is an interesting side issue. This could be a NOMA wall that separates science from metaphysics while providing a one way access for metaphysical processes, agents, designers, deities, etc to do whatever is needed.
Comment by Thought Provoker — July 5, 2007 @ 5:22 pm
July 5th, 2007 at 6:16 pm
stunney, "So, the physical world consists of embodied packets of intelligible information, described by the wavefunction of the universe."
Are you saying what exists is the product of the deterministic "laws of nature" (as we undertstand them) plus a universal wave function that is the source of all the non-deterministic quantum uncertainty level "input" into the otherwise deterministic system?
Comment by kornbelt888 — July 5, 2007 @ 6:16 pm
July 5th, 2007 at 9:36 pm
TP:
The formation of coded systems involves processes that are non-deterministic and non-random.
It is not a side issue for living organisms as encoding systems are a central feature of life. Neither can the sequential specificity of genomes be considered a metaphysical matter. It is a physical property of functional nucleic acids. I'll stay tuned TP because I hope there is more on this.
Comment by Bradford — July 5, 2007 @ 9:36 pm
July 5th, 2007 at 10:20 pm
Hi Bradford,
You wrote…
I am aware that this isn't a side issue for you. You have made it clear you want an answer to the origin of life. All the Third Choice offers is a mechanistic model, not a final answer.
If the Ultimate Engineer wishes to remain hidden, there is little we can do about it. We can notice that DNA and RNA are tiny quantum computers. And we can hypothesis how a telic universe could cause these computers to come into existence. However, "non-deterministic" means we can not determine how or why at the fundamental level of quantum effects.
Bradford, there are things I do not like about this Third Choice. There are things I would change if I could, but I can't (without lying to myself).
If you don't like this model, by all means present a better one. please.
Comment by Thought Provoker — July 5, 2007 @ 10:20 pm
July 5th, 2007 at 10:31 pm
So the model may have advantages and limitations. Is that a fair statement? As for OOL there are others concerned with it too and some disagree with my asssessment of the way things currently stand.
I'm not trying to be critical and in principle am willing to accept it as a viable model. I'm trying to understand what it could and would not explain.
Comment by Bradford — July 5, 2007 @ 10:31 pm
July 5th, 2007 at 11:05 pm
Hi Bradford,
You wrote…
I didn't think you were being critical. I actually would like to do a model to model comparison.
Comment by Thought Provoker — July 5, 2007 @ 11:05 pm
July 5th, 2007 at 11:37 pm
Stunney wrote:
You're being a little nit picky here. I was talking about life, and even the simplest forms of life require a code that is highly specified. OTOH I agree with you that everything in the universe can be described in terms of information. More precisely we can describe everything of space-time, matter-energy and information. Information in some form has always existed. You are correct. You cannot describe matter-energy without information. Duh! To describe anything you need information. However, I think that it's also legit to ask where did that information come from?
Have you read Charles Seife's book, Decoding the Universe? It explores what you have been talking about but from a non-ID'ists perspective. He even briefly describes and critiques the much-vaunted (at least for some people, well maybe just one person, we know) Penrose-Hameroff model.
He comments: "this idea of the quantum brain attracted a few physicists, some consciousness researchers, and a large number of mystics. (TP?) Most neurobiologists and cognitve scientists, however, didn't put much stock in the idea. Neither did quantum physicists; it was too speculative"
It's interesting how TP dismisses all the "˜big problems' as side issues. I think it would be more accurate to describe them as "˜side step' issues. Too bad it would be nice to see what he thinks about this kind of thing when he is not being a NOMA policeman.:smile:
Comment by JOHN_A_DESIGNER — July 5, 2007 @ 11:37 pm
July 6th, 2007 at 4:10 am
Kornbelt888 wrote:
I'm not sure I know what it is for a system to be deterministic at all. If we say something along the lines of "Given the set of conditions C, it is necessarily the case that effect E will occur", what are we saying other than if C, then E? But, even if this conditional statement is true, how do we ever know that C is 'given'? How do we ever know we have fully and accurately specified all the elements of C, and that C obtains? Maybe we failed to account for the gravitational effect on your trigger-finger of all the 'dark' matter in the universe, or that butterfly flapping its wings in Tokyo. So even before we get to the quantum level, there's plentiful uncertainty. We can be very uncertain about theoretically deterministic systems.
One might say that is just an epistemological limitation, not an ontological one. But perhaps there are no true exceptionless 'laws of nature'. Indeed, that's what I think is the case. There is just the wavefunction of the universe. That wavefunction certainly evolves deterministically in the sense that if one knows the wavefunction at t, one can predict with complete mathematical certitude what it will be at t+1. What's indeterministic is not the wavefunction itself, but rather the outcomes of measurements, in other words, 'collapses' of the wavefunction.
But nobody knows what a 'measurement' is. There's nothing in physics that tells us. The problem is that all physical systems or processes are included in the universe's wavefunction, so there's no physical way of uniquely determining what constitutes a measurement of the entire universe's wavefunction. Furthermore, quantum mechanical equations are time-symmetric. That is, there is no unique physical meaning to past and future as regards the wavefunction. It has no unique arrow of time. The waveform with a given initial condition (its form at t = 0), remains a solution of the time-independent Schrödinger equation for all later times.
The only thing that makes sense to me as candidates for being the causes of wavefunction collapses are the things that take measurements, namely measurers. Or, to use the common term, minds. They're the things to which the physcal world's 'intelligible packets of information' are logically correlative.
Comment by stunney — July 6, 2007 @ 4:10 am
July 6th, 2007 at 5:45 am
John A. Designer wrote:
Nope.
As to the main point, asking where information came from is, to my mind, like asking where God came from. I conceptualize God as unlimited or infinite information. God must be self-communicating information because God, by definition, is First Cause, Necessary Being, and Ontologically/Explanatorily Ultimate Reality, and because, by definition, information is that which is communicated. Information that is never, ever communicated just isn't information. In other words, eternally uncommunicated information is a contradiction in terms. Therefore the infinite information that = God doesn't get communicated by something else. And unlimited self-communicating Information is self-experienced as unlimited Consciousness and Value. (This is also why I think God is a Trinity. God = Information as Conscious and Valued = Being as Known and Loved.)
We are 'made in the image of God' because that's what we're like"”–information that is self-experienced as consciousness and value.
Comment by stunney — July 6, 2007 @ 5:45 am
July 6th, 2007 at 8:05 am
Hi Stunney,
Ok, now I am getting worried.
It is starting to sound like I'm agreeing with you.
If that doesn't prove the universe isn't deterministic, nothing will.
Comment by Thought Provoker — July 6, 2007 @ 8:05 am
July 6th, 2007 at 8:22 am
I understand being called a Quantum Quack. I don't mind as long as it provokes thinking.
As for Penrose-Hameroff being "too speculative", what is the alternative?
Many Worlds Interpretation?
And finally, I think the NOMA/OMA is very much the central issue in the Culture War. It's about who is claiming to know the one and only OMA Truth for us all. How can we claim to be "One Nation under God" without making the implied presumption that God exists? On the other side are the EA's claiming their version of the Truth is the only one.
Penrose-Hameroff doesn't argue for a single Truth. Ergo, it is a side issue for them.
However, if you would like to offer a model and arguments for what you think is the one and only OMA Truth. I will gladly put together one of my versions as a single OMA Truth and we can compare and constrast without side stepping the issue.
Here is an open thread Mike will probably wouldn't mind us using.
Are you up to the challenge?
Comment by Thought Provoker — July 6, 2007 @ 8:22 am
July 6th, 2007 at 12:32 pm
Hi, stunney,
Another problem with measurement is that it deceives people into thinking they know the essence of something. Take any material object, attach a few SI quantities to it, and you will have a hell of a hard time getting through to the average Joe that they don't know a damn thing about that object's essence. The problem with measurement is that the SI quantities are themselves defined in terms of matter. Which effectively makes it impossible to know what the essence of matter is, through measurment.
Comment by AnaxagorasRules — July 6, 2007 @ 12:32 pm
July 6th, 2007 at 3:24 pm
TP:
Debate? Isn't that what we have been doing? Let's finish this one first before moving onto something else. Unlike some people who can turn blogging into a life I do have a life outside the world wide web; so I'm somewhat limited on time.
Well, if I understand you correctly you've side stepped what many philosophers and scientist's (Paul Davies, for example) consider to be two of the three big problems: (1)the origin of the universe and (2)the origin of life. The third big problem that Davies lists is the origin of consciousness. Isn't consciousness really what the ORCH-OR paradigm is all about? This where ORCH-OR in my opinion is really disappointing because it fails to explain what consciousness is in the first place. In other words it doesn't address what has been referred as the hard problem. Though both Hameroff as well as Penrose (I think?) allude to the hard problem neither truly addresses it or gives any understanding to what the problems behind the problem really are. Of course maybe they do someplace, please refer me to those pages or papers if you know where. IMO basically all they are saying is that OR somehow explains consciousness. But, they never really get to explaining the how behind the somehow. In the end ORCH-OR is just another reductionistic theory only it invokes some the mystery, magic and weirdness associated with quantum mechanics. Of course I have not been as dedicated a student of ORCH-OR as you have been, so maybe I've missed something. Again, please fill me in if I have.
Comment by JOHN_A_DESIGNER — July 6, 2007 @ 3:24 pm
July 6th, 2007 at 4:27 pm
Hi, JOHN_A_DESIGNER,
In 1989, at least, Penrose isn't really sure. Here is a quote from "The Emporer's New Mind", from chapter one: Can A Computer Hava A Mind?" I will bold some salient points:
At this point in the book, Penrose is only just laying out the field, but when you read the chapter, and read between the lines, you understand what Penrose's envisions: A theory of consciousness, rigorous and exact enough to detect consciousness in any object, living or not, a theory that is more than just an observance of responses, and able to falisify a claim of consciousness for a thing, even if that thing passes the Turing Test.
He is not threatened by the fact that non-living things might have a consciousness, he is threatened by the fact that the test for consciousness will not be exact enough. That is what he wants to "reckon with".
At this point in the book, I have no idea why Penrose allows that it is possible for non-living things to be conscious. As you said, one must first know what consciousness is. Perhaps he will get into it, though I can't see how it could be defined other than by its abilities, which is not the same thing.
Comment by AnaxagorasRules — July 6, 2007 @ 4:27 pm
July 6th, 2007 at 5:22 pm
John_A:
It's just a mechanistic opening, John. It actually does address the 'hard problem' in a certain approach, because it leaves subjectivity as subjective. Yet real enough to count. The real 'hard problem' isn't qualia, IMO. It's whether or not conscious processes can be causal of states of brain, that are known to be causal of behavioral effects. It's entirely a causal problem. It is not really a problem of classification.
And you're entirely correct, since neither Penrose nor Hameroff have made the causal connections required for your (and many people's) satisfaction. I'm leaning on the opinion that because quantum processes are unpredictable in principle from outside the system itself, such questions cannot be definitively answered. All we have are statistics – probability. If you and I don't know if the cat's alive, we can't make any predictions that count. This says absolutely nothing at all about the cat, and its subjective-to-objective experience.
Comment by Joy — July 6, 2007 @ 5:22 pm
July 6th, 2007 at 6:45 pm
Hi John,
You wrote…
Joy gave you the polite response. Here is mine…
I take exception to your use of the term "side stepped" as to what I, personally, have done. I have proposed models discussing a possible origin of the universe here. I have reviewed Paul Davies' book on the subject here. And I generally agree with Davies since his views are very consistent with mine.
As for Origin of Life issues, that would involve too many links to mention. I have been trying to figure out something I can actually understand as opposed to just have faith in. My research into Penrose-Hameroff is part of this effort.
As for the study of consciousness. I find it incredible that you consider an earnest attempt of providing a detailed mechanistic model as "disappointing" while not offering up an alternative suggestion.
What would it take to have you less disappointed? A big booming voice saying you are conscious because I made you that way? Or the flip side, where a bunch of lab technicians show you a toaster that can carry on a conversation with you each morning? (see note).
Joy's hints are suggesting the possibility of a new kind of scientific study comimg out of all of this. Penrose-Hameroff "disappointing" efforts may find a definitive edge of something more than just evolution. An interface between classical science and a whole new realm that people felt was there but couldn't articulate.
Note: would killing your toaster be called "appliancide"? Chances are their would be quite a few instances of if this scenario ever came about.
Comment by Thought Provoker — July 6, 2007 @ 6:45 pm
July 6th, 2007 at 7:33 pm
TP:
Science isn't ready to go there. I don't know that it ever will (or can) go there. Here there may be NOMA-monsters. Note how completely willing they are to dive into its depths to salvage the ice on top.
Remember… what we are looking for is hidden not only in space, but also in time… [Tomb Raider -I].
Comment by Joy — July 6, 2007 @ 7:33 pm
July 7th, 2007 at 12:56 am
The double-slit is a fundamental, irreducible quantum phenomenon. It is the grand-daddy of the things people call quantum strangeness. The double slit is the same thing as 1-photon state entanglement, so in examining entanglement experiments, you will come back to this same irreducibly strange feature of quantum mechanics. The double-slit tells us that particles are extended. Entanglement experiments verify to what extent they are extended. What is meant here by 'extended'? To prevent invoking erroneous presuppositions about this, let's say that the nature of this 'extendendess' cannot be described by classical physics, and leave it that way for now.
Much of what appears to be strange in EPR type experiments can be removed. It certainly does not help to assign significations like 'let this photon be Bob' and 'let that photon be Alice' and they both have a hand of cards delt to them, and let the Nicol prism be a red choo-choo full of monkey-wax… Surely if you build a narrative of the experiment with these significations it will sound strange, for the wrong reasons. It obfuscates the real, irreducible strangeness. To find out what that is, you must eliminate as many presuppositions and obfuscations as you can. You must not introduce more.
For example, EPR experiments with spin sound spooky but much of this is an artifact due to the habit we have of only considering the z-projection of spin. If the experiment is analysed with a full representation of intrinsic spin, such as with the Bloch vector, then suddenly 90% of the spookiness goes away. But there remains an irreducible core. That core is what is really interesting.
St. Augustine's maxim is applicable: Believe and you will understand; faith precedes, intelligence follows. Do not jump into convoluted explanations before believing the facts that nature tells us: the facts that come from quantum optics experiments. These experiments force us to think more deeply about words like 'experiment', 'prepare', 'outcome', etc. But the results are what they are. Of course they are real. "What do they mean?" is a better question than "how can we explain them?". Because invariably what is meant by the word "explain" is the Kirchoffian sense: to explain in terms of bouncing balls and cosmic pinball-machine mechanisms.
The experiments tell us that at a fundamental level, nature wants to be understood in terms of operations and not just real numbers. Complex numbers are geometric operations – they have a dynamic quality to them, they extend the notion of passive quantity to transformations. Under this view, the number i is a 90 degree rotation, the number 1 is not just 1 dollar, but a 360 degree rotation. The number -3 is not just a 3 dollar debt, but a 180 degree rotation together with a stretch by 3. In book III of his lectures, Feynman goes quite far just by adding up complex numbers with certain simple rules.
Starting with complex numbers, you can build higher dynamic operations, represented by arrays full of complex numbers and so on. These can be used to represent things like spin. In general, such higher entities built out of complex numbers do not commute with each other, and experiments verify this. So again, experiments tell us that nature wants to be understood in terms of transformations and operations. This leads to peculiar things like superposition and entanglement.
A necessary consequence of this is that you can have a 2 particle state, say (fg) which cannot be factorized into the product of 1-particle states (f)(g). In the cases where (fg) can be factorized, you can say f and g are independent: (fg) – (f)(g) = 0 and there is no correlation (it kind of looks like the formula for statistical covariance). But, because of the view we have undertaken above, this factorization is not always possible. When (fg) – (f)(g) is not zero, f and g are correlated. Spin is intrinsic; it does not depend on distance. If (fg), (f) and (g) represent spin states then f and g remain correlated no matter what the distance. Such states are prepared from superpositions of states. Superposition is an irreducibly strange feature of quantum mechanics.
Dirac writes (1958)"by superposing a state with itself we cannot form any new state, but only the original state over again… [this] shows up very clearly the fundamental difference between the superposition of the quantum theory and any kind of classical superposition. In the case of a classical system for which a superposition principle holds, for instance a vibrating membrane, when one superposes a state with itself the result is a different state, with a different magnitude of the oscillations." Although entanglement can be found in classical physics, the irreducible strangeness of quantum superposition makes quantum entanglement irreducibly strange.
Therefore, you could say that the irreducible quantum spookiness is to be found in the double-slit, non-commuting quantities, and superposition. If an 'explanation' cannot 'explain' these, then it is worthless.
Appealing to Godel is like appealing to a red choo-choo full of monkey wax. Are you talking about formalizations of elementary arithmetic? No, so forget Godel.
NOMA? Instead of this NOMA thing, why not adopt a reasonable view based on proximate and distant causes? It's what people have always done when reasoning about things, until modern times that is.
Of course our descriptions of nature must be incomplete. This is a reasonable point, to anyone who is not a monist. Nature is what it is, despite our on-paper descriptions of it. Even mathematics is what it is, despite our formalizations of it. But this doesn't imply that there is no truth, no reality, and so on. There is no evidence that nature is deterministic in the monist sense (cosmic pinball machine). This does not imply that we cannot know about nature, or that what we know is not real, etc. We must disambiguate these words: truth, knowledge, determinism, formalism, axiomatic, algorithmic… and stop using them as synonyms.
Comment by Vladimir Krondan — July 7, 2007 @ 12:56 am
July 7th, 2007 at 11:44 am
Hi Joy,
You wrote…
I agree that classical scientists aren't ready to go there. I suspect there are some classical scientists who still refuse to accept General Relativity and look askance at Special Relativity.
I understand that Hawking and Penrose haven't received a Nobel Prize because their work isn't classical enough.
I find it ironic how readily some of these scientists appear to be willing to consider things like Many World Interpretation and 10 or 11 dimensional String Theories rather than accepting the experimental data as straight-forward evidence of reality.
Comment by Thought Provoker — July 7, 2007 @ 11:44 am
July 7th, 2007 at 12:39 pm
Hi Vladimir,
You wrote…
The classical double-slit experiment is just one hint out of many. It is vague enough to suggest only photons or electrons have a special property (at least until the same effect was shown with molecules). And, you still haven't addressed the GHZ state experiment other than wave away my attempts to make it understandable as somehow invalidating it.
I will gladly use a "red choo-choo full of monkey-wax" if it provokes thinking.
Before I went to bed last night, I was going to respond to your post by pointing out it was bombastic. That is, you used a lot of good-sounding words but didn't say very much. However, I thought better of it and waited until the morning as to give you the benefit of the doubt. I just finished a rather large and in-depth book where Penrose combined concepts forwarded by Feynman, Dirac and many others to get the reader to the point to understand the following.
"How, then, are we to treat the many-particle systems according to the standard non-relativistic Schrodinger picture?"¦[O]perators have to act on something and, for consistency of their interpretation, they must all act on the same thing. This is the wavefunction. As stated above, we must indeed have one wavefunction for the entire system, and this wavefunction must indeed be a function of the different position coordinates of all separate particles."Which I had already posted in this thread. Where I explained the duality expressed by Fourier Transformations on wavefunctions.
It should be obvious by now that I no longer see a universe of particles but rather an entire system described by a huge wavefunction.
So how do we explain this to a room full of people who are still think matter is materialistic?
Well, you see we "…have three observers (Alice, Bob and Cecilia)…".
Comment by Thought Provoker — July 7, 2007 @ 12:39 pm
July 7th, 2007 at 2:42 pm
TP:
GR is as 'classical' as it gets. They haven't received a Nobel because nobody wants to admit our knowledge breaks down at singularity – they're still kinda hoping these predictions will go away when the current Unitary Crisis is overcome by an entirely different theoretic that won't predict beginnings or endings or any kind of extremities. Say, infinitely propagating counterfactuals, for instance…
Or they could just be waiting for both of 'em to die (at least one of 'em has way outlived his life expectancy already). If they're dead, they don't qualify for a Nobel. Which is how they managed to get around acknowledging what was stolen from Rosalind Franklin in order to get Watson and Crick their million bucks. Jealousy can be an ugly thing… §;o)
Comment by Joy — July 7, 2007 @ 2:42 pm
July 7th, 2007 at 3:15 pm
Joy:
And you know this how? Don't forget to add those qualifiers.
Another reason might be that a lot of their great theoretical work has not been confirmed yet. It seems you only get a Nobel for theoretical physics if your predictions have some support, but I might be wrong. Black holes are rather difficult to study for obvious reasons.
It may please you to know that there are now Rosalind Franklin scholarships to promote participation of women in science.
Comment by Raevmo — July 7, 2007 @ 3:15 pm
July 7th, 2007 at 3:44 pm
Raevmo:
Yeah, you may be right, considering that nobody's ever claimed to have 'discovered' a black hole. They don't exist, nobody ever claimed they exist, they're not at the center of galaxies, and CERN isn't trying to create mini-holes just for fun and profit. Riiiight… This is why there are 8 full pages of black hole articles at ScienceDaily, such as:
Chandra Sees Remarkable Eclipse of Black Hole
Black Holes On the Loose
Now Scientists Think You'd be Roasted in a Black Hole
No Matter Their Size Black Holes 'Feed' in the Same Way
Hubble Uncovers Dust Disk Around Massive Black Hole
Polaroid Sunglasses Let Astronomers Take a Closer Look at Black Holes
Skinny Galaxy Has Supermassive Black Hole at Core, Just Like Bulging Galaxies
NASA's Chandra Finds Black Holes are 'Green'
Astronomers Measure Mass of Smallest Black Hole in a Galactic Nucleus
Just page 1, mind you, and not all of those. Note the verbs – "see," "find," "uncover," "measure." Looks to me like these things might "support" the existence of black holes (or perhaps the scientists who get paid to do this stuff are just lying through their teeth).
Hell, the sheer volume of Nobels passed around for ever-inventive and always-invisible sub-quantum beasties from the erstwhile Standard Model could inform anyone who cared to look that whatever's popular today is what gets a million bucks tomorrow. GR hasn't been very popular for awhile now, though black holes certainly are.
Maybe Hawking and Penrose will be happy with some scholarships in their name. Who needs a Nobel or a million bucks?
Comment by Joy — July 7, 2007 @ 3:44 pm
July 7th, 2007 at 4:00 pm
Joy:
Why do you so often use this rather despicable tactic of misrepresenting someone else's words? It reflects rather poorly on you. I haven't denied the existence of black holes at all; I'm quite convinced they exist. Were Hawkins & Penrose the first to predict black holes? They sure did derive some interesting properties of black holes (like Hawkins radiation), but as far as I know those properties have not been verified. I'm all for them getting a Nobel.
Comment by Raevmo — July 7, 2007 @ 4:00 pm
July 7th, 2007 at 7:03 pm
Subrahmanyan Chandrasekhar won the Nobel in 1983, but only for his early work on stellar structure and evolution. He was quite put-out that the committee ignored his lifetime achievements (including work on black holes), but Arthur Stanley Eddington's criticisms apparently weighed on the committee. One of those interminable turf wars astrophysics is so famous for.
Karl Schwarzschild produced important exact GR solutions for black holes, but died of an illness contracted in Russia during service in World War I. Robert Oppenheimer probably should have received a Nobel for his work on gravitational collapse, but he died before his name ever came up. Besides, he'd been branded a 'security' problem due to his opposition to nuclear proliferation and WMDs in general. Maybe he should'a won the prize for Peace.
Roy Kerr contributed a lot to GR solutions of the gravitational field if a massive object (like a black hole) were rotating. He won the Marcel Grossmann Award in 2006, but never a Nobel. John Wheeler worked directly with Einstein on the unified field, and gave "black holes" their name. Among his grad students were Richard Feynman and Hugh Everett. He also formulated the first version of geometrodynamics and developed with Bryce DeWitt the Wheeler-DeWitt equation – the "wave function of the universe." He won the Wolf Prize in 1997, but never a Nobel.
Riccado Giacconi won a Nobel in 2002 for contributions to astrophysics (which led to the discovery of X-ray sources), and it is argued that black holes are X-ray sources. But I don't think that counts, since Giacconi didn't do any actual work on black hole theoretics. Albert Einstein won a Nobel in 1921 for "general contributions" to theoretical physics, but mostly for photoelectric effect rather than SR or GR.
So it doesn't look like anybody associated with black hole theoretics has ever been awarded a Nobel for it. So Hawking and Penrose are in good company.
Comment by Joy — July 7, 2007 @ 7:03 pm
July 8th, 2007 at 6:36 am
Probably has more to do with the difficulty of separating wrongness from not even wrongness in the GR world.
Don't know about CERN's black holes but this piece of tripe about Brookhaven's black holes is one of the funniest not even wrong papers in a long time.
I often wonder about this possibility.
Comment by Vladimir Krondan — July 8, 2007 @ 6:36 am
July 8th, 2007 at 12:53 pm
Vlad:
My point was actually to highlight the volume of Nobels awarded to predictors of various critters. Muons, pions, neutrinos, quarks… you name it, there's somebody out there who got a million bucks for "finding" it. And of course, the more awards that went to the club, the more influence the club members had over nominations and evaluations. IOW, a closed system, with heavy emphasis on RQFT. Einstein's Nobel wasn't for Relativity. So it's not surprising there's a dearth of Nobels for predictions from Relativity.
They have to do something to justify themselves. When the Texas Supercollider was defeated some years ago, they were stuck trying to invent new 'experiments' for what they already had. Plus some substantial upkeep increases on the budgeting end for 'necessities' like superconducting magnets in the tunnels and extra storage toruses and all.
Truth is, our government is heavily invested in RQFT – the good ol' Standard Model – to the tune of trillions. These fancy toys are certainly impressive to look at and fun to ride, though a peek inside demonstrates some quite odd mental states among the live-ins (usually post-grad 'grunts' who man the target zones, sleep on the concrete floor for months at a time and seldom bathe). Leads to some rather humorous situations…
They never actually 'see' any of the beasties they purportedly produce. The project leaders just gather the detector data and pore over it (again for months or years) attaching names to this tick or that tock and drawing circles around the clicks that look particularly impressive. What they were supposed to be seeking was Wiggly Higgly (the Tevatron's entire pitch for funding was tied to Higgs), but he's still notoriously MIA at more than twice the predicted energy level (part of the "Unitary Crisis"). So they must come up with potentially useful OTHER beasties to justify the expense.
"We've got Quarks and Gluons!" one shouts. "Naw, it's Mini-Holes!" corrects another. Missing some neutrinos? Just add some mass. Can't find Higgs to account for that mass? Just fudge the prediction to energy levels you can't achieve, tell your sponsors you need a bigger machine and another trillion bucks. Do your bosons look to have acquired some mass when they weren't supposed to? Deny, deny, deny. It's all really quite impressive, in a strange sort of way. Unitary crisis or no unitary crisis, they still have great faith. Keep pouring more energy into the conversion machine and more nifty kinds of beasties come out. Almost as if energy really can be converted to matter (the flip-side of GR's famous equation that gifted us with nuclear WMDs).
I try to give 'em the benefit of doubt. They're simply committed, thus overwhelmingly hopeful. We call that "wishful thinking."
As for Brookhaven's desire to capture the flag (over FermiLab and CERN), they've come up with weirder things than mere mini-holes. A few years ago as they were fixing to install the RHIC, the question arose as to how any mess of loose quarks they might produce would recombine (as quarks are wont to do within the space and time of Uncertainty). Seems there was a small but statistically considerable probability that a "Strangelet" would be produced. A non-naturally occurring particle of matter composed entirely of strange quarks.
See, there's a good reason strangelets don't exist naturally in this universe. This theoretical beastie would be completely stable, and our universe of form and motion requires a certain inherent instability in order to provide the conditions life requires – one of those "Fine-Tuning" issues. A serious argument erupted between the theorists and the experimentalists (and grunts) about the implications of such a thing, and whether or not the experiment should proceed. Unlike most in-house arguments, this one managed to go public.
Deal is, the prediction of what would occur if a strangelet were accidentally produced wasn't good. Worst case scenario: An instantaneous universal change of phase that would render everything completely stable. Thus terminating all life here and anywhere else in the universe where it may have gained a foothold. Lesser case scenario: only the earth would be destroyed. Either way, for some of the theorists and most all of the public, seemed an outrageous risk to take just so some terminally egotistical eggheads could play a highly radioactive game of "QuarkMaster" on our dime.
Brookhaven's director decided to go ahead anyway, rationalizing the risk as both minimal and irrelevant – because if all life were instantaneously wiped out, nobody would be around to care and no lawsuits would ensue. How's that for a spectacular display of hubris and bureaucratic idiocy all at the same time?
Comment by Joy — July 8, 2007 @ 12:53 pm
July 8th, 2007 at 1:51 pm
Joy:
Perhaps that's why we haven't encountered any extraterrestrial intelligent life. Their physicists always ended up creating strangelets in their colliders. I hypothesize that dark matter is nothing but the strangelet remains of ancient civilizations.
Still, it's only matter. Our immaterial souls have nothing to worry about.
Comment by Raevmo — July 8, 2007 @ 1:51 pm
July 8th, 2007 at 4:12 pm
Raevmo:
True enough, and mighty white of you to say so. Most people alive today have been living with the strong probability that Almighty Science will render life extinct on this planet one way or another all their lives, it doesn't really matter which one the politicians they serve choose to use. By the time I was 11 I'd come to terms with it. Others live in abject denial, while some are quite proud of our suicidal tendencies.
The strangelet episode is useful to illustrate the attitude, that's all. Power is and has always been the name of the game, and those who thirst for power really don't care if they make the whole quest obsolete in the process. What any of the rest of us think is irrelevant. This is why when I see scientists doing their Chicken Little act about global warming as The Greatest Threat To Civilization since WMDs (which they invented and helped to proliferate, to this very day), I yawn. Only an idiot or a child would believe they care.
Comment by Joy — July 8, 2007 @ 4:12 pm
July 8th, 2007 at 4:29 pm
Joy:
That makes me an idiot then. While I'm quite sure that some climatologists are motivated by prospects of increased funding for their research, it's a bit too cynical for my taste to declare the whole bunch heartless liars. The vast majority of scientists that I know have hearts, and in the right place to boot.
Comment by Raevmo — July 8, 2007 @ 4:29 pm
July 8th, 2007 at 4:59 pm
Raevmo:
No doubt some do. Hopefully they conduct their lives as exemplary of how individuals should deal with this. You know… bicycling to work and store or driving an SVO diesel that fuels at McDonald's, taking cold showers (or having a solar heater on the roof), using home-generated electricity, lighting with candles (or whale oil – NOT kerosene), living in an earth-sheltered hobbit-hole, compressing methane from feed lot waste for the grill, the gas heater and the bunsen burners at work…
…and stumping 3 days a week for nuclear power (for $100K a year, of course).
Comment by Joy — July 8, 2007 @ 4:59 pm
July 8th, 2007 at 5:12 pm
Joy:
Spooky. Are you following me or something?
Or maybe governments could invest a bit more in developing alternative sources of energy. But how likely is that if the oil companies run your country?
Comment by Raevmo — July 8, 2007 @ 5:12 pm
July 8th, 2007 at 5:54 pm
Raevmo:
LOL!!! Oh, my 'vintage' Mercedes that only gets 23 mpg runs on biodiesel because I can't afford the thousand dollar conversion kit, and don't get out enough to raid McDonald's anyway (who would WANT to?). My nearest city mandated all city diesel fleets (including buses and garbage trucks) use biodiesel years ago, so it's always available. Walking can be a chore around here (driveway's half a mile long and the first half is straight up the mountain), but as fast as biking and less tiring. I site-heat water (since there's only one bath and one kitchen), but it is pre-heated solar. Which is convenient, since it comes out of the spring at <40º no matter what time of year it is.
Only the first floor is in the mountain on 3 sides, the main and loft above that, alee of the downdrafts from Mt. Mitchell. But I'd sure love to construct a hobbit-hole house into the ridge and grow wildflowers on the roof. Maybe I'll win the lottery someday (but then I'd have to play…). Do have those mercury-laden mini-tubes instead of light bulbs, everywhere but in the track lighting (kitchen) Bob Vila convinced me to install years ago. And we heat with wood. Clever system, 3-story pipe. Someday (after that big lottery win) I'm going to install ram jets on the creeks both sides of the ridge. One just to pump spring water to a ridgetop cistern (gravity feed!) and one to generate electricity (direct). When I get solar panels for the south side roof, Duke has to give me a backwards meter. I already have the hammock which I plan to park right next to it while I drink lemonade (or good beer) and watch that sucker run!
It's a coming sea-change, multi-generational. It should have been done long ago, or at least before we ended up where we are today. I mean, it's not like we didn't see it coming – this is Granny talking. Boomers took over awhile ago.
Government's a problem, but mostly it's a reflection of deeper issues, particularly glaring in recent years. The planned economy is a bigger wall that needs destructing. They've got us so tied up in outsourcing and crooked Chinese slave-labor trade gaffs (that kill people and other living things quite regularly) that we're too distracted to see that it's all right here, right now. We could do it tomorrow if we really wanted to. Or if our 'overlords' would let us.
…without nuclear power.
Comment by Joy — July 8, 2007 @ 5:54 pm
July 8th, 2007 at 6:18 pm
Joy:
I think nuclear power is quite safe these days, but hardly cheaper than the most advanced kind of solar power that's available now. It's all about profit. If everybody would cover their roofs with solar panels, there wouldn't be a problem. There wouldn't be a war in Iraq either.
Comment by Raevmo — July 8, 2007 @ 6:18 pm
July 8th, 2007 at 6:53 pm
Yeah, we'd all live happily ever after.
Comment by Bradford — July 8, 2007 @ 6:53 pm
July 8th, 2007 at 7:13 pm
Raevmo:
No, it's not. We haven't even got a prototype of these PBRs (and I'm not talking cheap beer) yet, much less any realistic projections on all the issues on the list. It would be 40 years before the first one could be built commercially, and according to all the scientists doing the Chicken Little act, that's way too late to count.
Sure, we could really underwrite solar panels. A majority of homes and buildings in the "Sun Belt" could be producing 200 or more days a year. Not as much as they use, though, since as the "Sun Belt" moves north, air conditioning bills do too. Tidal is a viable technology. Geothermal could be further exploited, and there are literally hundreds of "reserve" lakes in Texas and Oklahoma that need only turbines to be producing. They were all built by the CCC and Corps of Engineers, have been there since the '30s, so environmental impact is a moot point.
Heck, if we really wanted to get creative, we could actually enforce laws that have been on the books since the '70s to make coal plants and coal-fired factories install available, well-designed scrubbers. Or make GM come off its joint (with EPA) patent for that new passenger vehicle diesel, SVO out of the factory. Maybe put biodiesel in the tanks at truck stops on all our interstates. Revamp our agricultural policy away from GE staples nobody wants to eat and corn for HFCS and ethanol, toward oil crops. Engineer THOSE. No one will care, so long as they don't get in the food supply. Farmers might even stop growing marijuana as their #1 cash crop in all 50 states…
There's whole new fortunes to be made. But it won't happen so long as Exxon-Mobile, et al. pull the strings. They're sitting on innovative technology right now so they can still soak our last pennies before deploying (and pretending to be our saviors). As I said, it could happen tomorrow.
P.S. I was in Texas and Oklahoma in the early '80s. I was there to see 'em cap the wells, on orders from the gub'ment. The better to foment recession now and justify wars of aggression down the road, my dear! Never forget: "WE ARE THE ARABS." [Marlon Brando, The Formula]. And they don't call the prince of Saudia Arabia "Bandar Bush" for nothing…
Comment by Joy — July 8, 2007 @ 7:13 pm
July 8th, 2007 at 7:21 pm
I almost entirely agree with you on this, Joy. How about that? We have something in common after all.
Comment by Raevmo — July 8, 2007 @ 7:21 pm
July 8th, 2007 at 7:57 pm
Bradford:
Bradford, we already know you and I don't see eye to eye on things sociopolitical. But I've gotta say it strikes me tragic that you think Iraq is a 'good' thing. But then, there be Veterans here…
I won't indulge this off-topic diversion further. I'd just remind you that if we believe in God – or something that looks just like him – we've a responsibility here. Nobody lives happily ever after, never did. In any age, under any sociopolitical system. We get to live in "interesting times," as the old Chinese curse goes. We're fairly cursed by the Chinese right now. Not just in trade – though thousands of furniture and textile jobs in my region have moved there in recent years – but also because they've been purchasing our debt. You do understand that we're buying this war on credit, don't you? It's not like last time, when the Japanese underwrote it…
We're already a 2nd-world country, and not just because the whole world watched the non-response to Katrina (so much for "National Security"). Worse than that on quality of life issues like health care, where we rank 37th in the world. Our greed has ruined us. Which means we've got some atoning to do, shouldn't wait for Bandar Bush's permission before we start doing it. Challenge is the spice of life – and even rose gardens have thorns, yada yada yada. C'mon, we're tougher than this! Or… we once were.
Comment by Joy — July 8, 2007 @ 7:57 pm
July 8th, 2007 at 8:03 pm
Hi Joy,
You wrote…
You have convinced me to change my opinion once (God and dice), you may be doing it again on which threat is bigger (religon or science).
One of the issues I have struggled with is understanding why a telic universe would need intelligence to make it complete. I even speculated on how human activity (like SETI) might be needed to bring order in the end.
However, I couldn't think of what humans could possibilty do that was significatant enough to bring about an orderly collapse of the universe. It would have to be extreme. Something like an "…instantaneous universal change of phase".
hmmm
Comment by Thought Provoker — July 8, 2007 @ 8:03 pm
July 8th, 2007 at 8:25 pm
TP:
"Order?" If by that you mean stability, stability means we don't exist. Do read Prigogine if you get the chance. Or even an old classic by Schrodinger – What is Life? "Order" sounds way to Fascistic for my tastes. Maybe that's because my Godparents had tattoos on their wrists.
The blatant hand-waving and dismissals – IN PUBLIC! – were enough to turn millions in Megopolis against scientists all by itself. So I am generally wry when scientists whine about their bad reputation. They earned it the hard way, so who am I to defend them?
…though I know not all scientists belong to powerful enough clubs to wield Big Swords. Atom-Smashers do. And they get a big chunk of the budget too, for not a whole lot. It's pure economics. They've gotten more than their share for so long that it's automatic. "Unitary Crisis" or not. It's the attitude I despise.
Don't worry. I'm not of the opinion they're likely to create a strangelet, and if they do they could always isolate it in one of the plasma toruses. Until they figure out what to do with it. I'll die when my time comes. Everybody could go with me, but I'm not holding my breath… §;o)
Comment by Joy — July 8, 2007 @ 8:25 pm
July 8th, 2007 at 8:41 pm
TP:
There's stuff of way more day-to-day importance. Back in 1980 the NRC shut down the Los Alamos linear collider (after several years' worth of "yeah, and…" vs. "Yeah, but…" because increasing traffic patterns on the federal highway had them neutron activating the locals during rush hour twice a day.
12 feet of metal-heavy concrete walls helped, I think they're up and running today. They could have done that years and years before. If they'd cared. Guess it was easier to blame the highest per-capita cancer rate in the nation (in the highest-IQ population in the nation – LA/Santa Fe) on green chili peppers. But then they had to explain the tritium dumping into arroyos that were used to irrigate the chili crops…
Sometimes you just can't win. Best to just burn it down…
Comment by Joy — July 8, 2007 @ 8:41 pm
July 8th, 2007 at 10:11 pm
AnaxagorasRules wrote:
A couple months ago while trying to make airline reservations I ended up with one of these voice recognition programs, which I, a long with a lot of other people I know, hate using. I'm old fashioned in that sense; I just don't like talking to a machine. That got me thinking, what if they improved this thing so it could interact with me so well (seamlessly, pleasantly and personally) that I couldn't tell the difference between "it" and real live human agent? Wouldn't that be good for business? Wouldn't that be passing the Turing test? Yet, would such a program be anywhere close to being self consciously aware? I don't think so. We would know from a design view point that awareness wasn't built into it. From the stand point of consciousness such a program is a "zombie." We would know objectively that it is nothing more than a very sophisticated algorithmically driven program. Human designers do not know how to build awareness into a machine. From the stand point of consciousness the "˜virtual reservationist' (VR)program described above is a "zombie." It has no more idea that it exists than a door knob. Furthermore, no one has been able to prove that self conscious awareness will result by simply building bigger or faster computers, better circuitry or programs.
How do we know all this? We know this because self-conscious awareness is our first order experience. We can communicate with other human being relate to their experiences, but that is the only way to "˜objectively' investigate conscious awareness which is subjective and private. In my opinion this is the hard problem. This is why self conscious awareness is so resistant to reductive explanations including the ORCH-OR model.
BTW I think it won't be that long before we actually see VR programs that I have described above.
Comment by JOHN_A_DESIGNER — July 8, 2007 @ 10:11 pm
July 9th, 2007 at 1:28 am
Hi, JOHN_A_DESIGNER,
Since I made that comment, I've thought quite a bit about this idea of non-living things having a consciousness. Penrose point blank states that he thinks Searle's assertion that only biological things can have one is too dogmatic. He allows that a nonliving machine might be built that can think, feel, and have a consciousness.
In thinking about this, to be consistent with my model of reality, I also have to refrain from arbitrarily ruling out nonliving systems and devices from having a consciousness.
With the exception of myself (I automatically know myself from direct experience), the only way I can perceive or detect anything is by way of obsevance, either with the senses or by way of instrumentation. And in every case, it is the behavior of the thing that gives the thing its structure.
To give an example of what I mean. If there is a piece of paper on a table, I perceive that piece of paper because it is behaving like a piece of paper. Even though the paper seems to be rest, it is not. Think of a college cheerleader team, where the members have all climbed on each other's shoulders to errect some kind of structure. The structure seems stable and stationary, but only because the team members are furiously working to make it so. The paper is the structure, the atoms and its constituents are the team members, furiously at work to keep that piece of paper being a piece of paper.
So, I can't ever ignore behavior, even if it's the behavior of a nonliving thing that is mimicking thinking. Behavior is how I distinguish one thing from another. It is through behavior that I perceive the world. I can't just say except in this case. I might as well toss my entire world view out the window (well, I wouldn't go that far, but the exclusion would mar the aesthetics). I have a model of reality that is very platonic in nature. In my world view, all material objects are mimicking one concept or another, in many cases many concepts.
I would need the concept of a nonliving, non-human conciousness, to make sense out of this, a new form so to speak.
I can understand why Penrose is so discombulated about this, as a lot of wackiness could ensue. The AI guys, according to him, are being way to generous in what constitutes a nonliving thinking and feeling machine. I could open up my Visual Studio IDE, and write a program in a jiffy that could express pain, happiness, anger, any emotion I cared to program into it. I could run the program, and input a string telling it that I just smacked the side of the console, and have it respond with an output saying that it is feeling pain. So, is it feeling pain? Do I now have a conscious machine on my hands that is feeling pain? What would the AI guys say? Yes? No? Penrose says that the only factor, as far as the AI guys are concerned, that determines a yes or a no is the level of the complexity of the machine's response.
The overarching principle here, I think, that the AI guys are making, and that Penrose is supporting, is that consciousness can be disassociated from any particular type of matter. But this is getting the AI information second hand. I'm curious enough to browse through some books on AI to see what they are in fact claiming in their own words.
Comment by AnaxagorasRules — July 9, 2007 @ 1:28 am
July 9th, 2007 at 8:49 am
I guess I still don't understand the Third Choice. Maybe somebody other than TP can give me a simple explanation, other than it involves QM. I think I understood McFadden's book Quantum Evolution, at least enough to give a 1-2 paragraph summary of it, even though I wasn't necessarily sold.
A couple of quick criticisms that may miss the point, but that stand out.
Most folks, including most scientists, biologists or what have you, don't equate "planned" with "supernatural". I think Mike Gene caught Dawkins a while ago backing away from his "free will is an illusion" stance. Now, it may be an illusion, but if that is the case, then these discussions become an absurdity as a necessity, not just as a practicality.
Why does life "need" anything, including a randomizer?
You seem to think Dr Dembski would disagree with that statement, but I'm not sure he would at all. The UPB is NOT a boundary of the possible vs the impossible, but a boundary on the rational explanation vs irrational.
I don't understand that at all. Needs? Tools? Before life "evolved", was the universe inconsistent? If so, consistency wouldn't seem to be a need. If not, life wouldn't seem to be necessary for it, and the logic goes up in smoke.
Again, I don't claim to really understand the Third Choice. But what little I seem to understand makes it a lot more metaphysical a theory than ID ever was/is.
Comment by RogerRabbitt — July 9, 2007 @ 8:49 am
July 9th, 2007 at 9:51 am
Hi AnaxagorasRules,
You probably need look no farther than your namesake as a starting point. I view Anaxagoras as the first Western idealist. He seemed to agree with the atomists that reality was made up of "little things", matter, but claimed that nous (mind, intellect) was required to get and keep them moving. This makes Mind fundamental to reality just as many modern philosphers of mind and process thinkers suggest that consciousness is also fundamental.
So if mind and consciousness are fundamental then even non-living things either have some form of intrinsic consciousness(panpsychism) or there is an absolute mind/consciousness (idealism) creating reality. The problem with panpsychism or subjective idealism is the combination problem that William James raised. How can there be a unified experience. The solution is an absolute idealism, a unification of mind in the One Mind. With this solution it is possible to speak coherently of inanimate objects having at least an aspect of mind/consciousness.
Comment by Steve Petermann — July 9, 2007 @ 9:51 am
July 10th, 2007 at 1:26 pm
Hi RogerRabbitt,
You wrote…
I took this as an indication that you wanted me to let other people have a chance so I waited at least 24 hours before responding.
I hope you don't mind if I offer some further explanations based on your questions…
I wrote… "A designer-centric term for this would be "planned". A mainstream scientific term would be "supernatural"."
To which you reacted with…
What I was talking about was evidence of retrocausality occuring in nature. The different terms are used to frame the debate. What looks "planned" to one person could be taken as "precognitive" to another. "Planned" is a loaded term (it implies a designer), so is "precognitive" (it implies supernatural). Trying to explain the concept in a generalized way is difficult. Penrose used the term "rediction" for backwards prediction. I use "retrocausal" to loosely cover all of the above.
I have little interest in what MikeGene caught Dawkins doing. I am trying to focus on science, not politics, with the Third Choice. I agree that Free Will continues to be a question, but I contend it is easier to understand and explain Free Will under the Third Choice compared to the other two choices.
I am not sure if you are asking why life needs to exist at all or why life needs to be non-deterministic. I suggest life exists and needs to be non-deterministic to be of any use to the telic universe (or God).
I would be very much interested in Dr. Dembski's reaction to the suggestion that there is no such thing as naturally occuring randomness. He might agree that this means everything is designed. I think even Ken Miller (and many other people) hold the opinion that everything was designed by God.
The Third Choice presumes nothing is actually random, some thing are just so interconnected that they appear to be random. Does that make the Third Choice a rational explanation?
Only if you assume "before" and "after" mean anything to a telic universe. Everything in the universe is interconnect both in space AND TIME. I don't know why life is needed to make the universe consistent, but it is a good bet that life is needed.
Paul Davies had some suggestions and illustrations of a universal casual loop in his book, Cosmic Jackpot. Explaining the existence of the universe as a giant casual loop is not new (Have you seen Hindu paintings of a snake eating it's tail?). The usual complaints revolve around how we view time and the possibility of casual paradoxes. Penrose's combination of General Relativity and Quantum Mechanics shows how all of this can make sense as being reality. IMO, he explained it quite well in his book, The Road to Reality.
Comment by Thought Provoker — July 10, 2007 @ 1:26 pm
July 11th, 2007 at 7:37 am
Not at all, but I don't think I'm any closer to grasping the point of your theory.
And what is that evidence? If we are talking about the current dispute (or indeed most scientific investigation), both the IDers and the Darwinists generally see time having an arrow pointing in one direction. They see a before and after. Indeed, what will science look like if there is no before or after?
I'm not saying that time isn't in some sense an illusion. I'm willing to accept that premise in an attempt to understand your theory, I just don't grasp how it helps explain the point at issue.
If the assumption a priori is one of a telic universe, then it seems to fail to be an alternative to either of the other two main positions, which in their purest form don't require any out of the mainstream a priori philosophical assumptions. There isn't anything innately wrong with such assumptions, but it is unlikely to appeal to those who don't share those assumptions.
I think the issue of random v pseudo-random isn't the issue. The Third Choice may be internally consistent with the a priori assumptions, but it doesn't appear to be a rational explanation of what we see. That may be only because I don't understand what the logic is.
That may be because you are only focused on "mechanism", and I'm still focused on the "whether or not" question, and I can't see how your theory moves that question along.
I'm not sure how you could make any conclusions about the odds, other than your own assumptions. That's circular logic. That's fine for you. It isn't likely to attract the interest of folks who aren't driven by the same assumptions. Both Darwinism and ID can point to some objective evidence to attract the objective observer. I'm not sure where the "hook" is in your theory. It may indeed be true. But no logic seems to take me to that conclusion.
Loaded? No, it is merely a word that has a meaning that humans can grasp. You can disagree with the conclusion of IDers, but still grasp the concept of "planned". That was the point of my free will citation of Dawkins and Mike Gene. It isn't merely politics or social issues or religion at issue, but a basic world view that people have, and how they can merge your theory into that world view. If free will is an illusion, laws, societies and science itself make little or no sense. In your theory, if before and after have no meaning, Darwinism, ID and pretty much science itself make no rational sense.
It may be that those issues can be resolved. But until such a resolution, I'm not sure why I'd want to go there.
Comment by RogerRabbitt — July 11, 2007 @ 7:37 am
July 11th, 2007 at 8:37 am
And BTW, I doubt statements like this from you because of other statements you make, such as:
Not only am I 99.999…% convinced that statement is wrong, but it is you who brings up the "ID MOVEMENT". The more YOU bring it up, the less people will focus on your "mechanism".
Comment by RogerRabbitt — July 11, 2007 @ 8:37 am
July 11th, 2007 at 1:32 pm
Hi RogerRabbitt,
You wrote…
I suspect it is more that you find it unappealing as opposed to not understanding it. I also find parts unappealing. Rock asked about a Fourth Choice. I wouldn't mind another alternative myself.
Since I am defining the term "retrocausality" to include conscious planning, then most, if not all, evidence that supports Front Loading is also evidence supporting retrocausality.
Science isn't supposed to be a popularity contest. The majority of people would be happy thinking in terms of Euclidean three space and Newtonian physics. It is unappealling to think General Relativity and Minkowski Space more accurately describe reality.
Penrose uses Minkowski Space as the basis of his Twistor model to explain quantum effects. Various String Threories are more popular, but I am beginning to see why Joy remains unimpressed with them.
Penrose-Hameroff takes one more logical step into biology. DNA strands and microtubules appear to be mini quantum computers according to Hameroff. While it may be unappealing to combine the two realities (quantum mechanics and organic processes), we may have no choice.
This argument is hard to understand. Behe, Dembski and others are questioning whether or not Random Mutations are truly random or just pre-determined. Pseudo-random is deterministic and, therefore, predetermined. A Third Choice is a non-deterministic and non-random process.
As I said, I suggest you are understanding things, but don't like the implications. The Third Choice leaves open the question of whether or not there is a God. I embrace NOMA. I consider metaphysical questions beyond the reach of science.
Then point to the evidence for ID. Behe's evidence in Edge of Evolution supports the Third Choice. Front Loading evidence supports the Third Choice. The quantum mechanical evidence of GHZ states supports the Third Choice. Libet's consciousness experiments support the Third Choice.
There are plenty of hooks for people if they are more focused on science than answering metaphysical questions.
Comment by Thought Provoker — July 11, 2007 @ 1:32 pm
July 11th, 2007 at 2:20 pm
Another problem that I have with the ORCH-OR model is the ORCH part. ORCH supposedly means to orchestrate or to be orchestrated. But, what do we mean by that?
Consider what an actual orchestra is and what it does. For example, an orchestra wants to play Beethoven's 9th Symphony. What is needed for it to accomplish that task? Well, first of all we know that an orchestra is made of numerous members and parts: musicians and musical instruments. Let's discount for the moment that the musician's are intelligent beings and their instruments are intelligently designed: how exactly does an orchestra produce a symphony like Beethoven's 9th? The answer is that by itself an orchestra does not and indeed cannot orchestrate. In other words, by itself from the bottom up an orchestra cannot produce anything like a symphony even though it is necessary to perform a symphony. A symphony requires an intelligent composer who works from the top down.
As I see the ORCH-OR model is little more than a bottoms up approach that pretends that because it has discovered some parts of the orchestra (albeit parts that operate mysteriously by some kind of quantum effect) that that automatically explains how something like real world consciousness and thought takes place. It explains little to nothing. Orchestration is a top down process, which requires creative foresight, planning and purpose. IMO to explain anything like human intelligent thought and consciousness requires an explanation that is top down, not bottom up. In other words, how can unintelligent processes give rise to something like mind and intelligence? Like all materialistic or naturalistic explanations ORCH-OR fails to answer that basic question. Like them it hides behind the skirts of euphemism and metaphor. Of course, maybe orchestration (ORCH) is a bad choice of words. That may very well be the case. However, even then, I still don't see in ORCH-OR anything close to a rigorous explanation that explains either what consciousness really is or why it exists.
Comment by JOHN_A_DESIGNER — July 11, 2007 @ 2:20 pm
July 11th, 2007 at 5:12 pm
Hi John,
You wrote…
A complete investigation requires both top-down AND bottom-up analyses. It has to make sense from all points of view.
That is why I think Orchestrated Objective Reduction is a pretty good choice for a name.
While we may agree on the need for the top-down view, I think we might disagree on the application of NOMA principles and our limitations.
Many ID proponents don't feel the identity of the designer is relevant. My take is slightly different. I think the identity of the orchestrating process and/or agency is relevant, but it looks like it is non-deterministic. Our ability to determine the ultimate cause is inherently limited.
We are forced to start our top-down analysis by starting with orchestrated quanglement. Orchestrated quanglement. is the science side of the NOMA wall. Everything on the other side is metaphysical, to be argued using the philosophical tool set.
Philosophers have been dealing with the paradox of searching for unknowable Truths for over 2000 years. I am comfortable this trend will continue.
In science, all we can do is our best using the evidence available to us. IMO, our best includes combining General Relativity, Quantum Theory and Evolutionary Biology into a unifying hypothesis, a Third Choice.
Comment by Thought Provoker — July 11, 2007 @ 5:12 pm
July 12th, 2007 at 8:22 am
And that's why I was hoping somebody else could give me a brief explanation, because simple inquiries get treated as evidence of opposition, and you react defensively. I think we went thru this same dance with the morality v ethics discussion.
Having said that, I'm a at a little bit of a disadvantage. It may be that, as you claim, I know all there is to know about your theory. In that case, I indeed don't like it, not because of any threat to my worldview, but because it seems to add nothing to the debate. It doesn't appear to be science in any meaningful sense, but then again, I don't know what you mean by science.
True, but there is an element of trying to convince other scientists, or indeed, people in general, of the logic of one's position or theory, based on the evidence. Indeed, that's why publishing is so important. It allows for a public dialogue. You're free to respond to criticisms as you did above, but your point is a hollow one.
Now I think we may be talking at crosspurposes because of the differing meanings of random. Let me clarify what my point was. Behe, Dembski and others are not raising the issue of whether random changes are truly random (whatever that means in reality) vs deterministic, but that if they are random with respect to fitness (regardless if they are deterministic), that Darwinian Evolution seems to be unable to explain the complexity we see in life. The former confict may have all kinds of metaphysical overtones, the latter is merely an effort in logic and rationality.
Well, here's what you said above:
Without getting too deep into definitions, that makes your assumptions metaphysical, being deistic or theistic, and while there isn't anything wrong with that for your worldview, it isn't likely to appeal to folks who don't want to share that worldview as an a priori condition of their doing science. ID comes without that a priori precondition.
The EoE does that fairly well. Random with respect to fitness doesn't seem to explain, design, which we can readily see around us, can explain the complexity we see. It doesn't prove ID, but it is evidence. May be misleading evidence in the long run. We'll just have to wait and see.
I see nothing in EoE that supports what I understand to be your TC. I can see where it might be consistent with TC, as it could be consistent with lots of theories. But, ID doesn't carry the metaphysical baggage yours does.
Comment by RogerRabbitt — July 12, 2007 @ 8:22 am
July 12th, 2007 at 3:21 pm
Hi RodgerRabbitt,
You wrote…
I'm sorry you feel that way. I meant it as a compliment. You have stike me as having the ability to understand this.
Behe says "…even though [ acknowledges I agree with what he claims is the great bulk of evolutionary thinking, he would realize that the question of randomness versus design is actually the crucial point, both scientifically and otherwise. The rest are details."
link
I suggest all three choices have "…all kinds of metaphysical overtones." However, there are plenty of other threads available for engaging in dueling metaphysics. I am trying to focus on science in this one.
I am offering the Third Choice as an ID Hypothesis without any a priori preconditions.
The hypothesis is still valid whether or not one assumes an metaphysical agency exists. The hypothesis suggests detecting design by look for a non-deterministic process in nature (quanglement).
Evidence that is consistent with a hypothesis supports the hypothesis.
The Third Choice is supported by most, if not all, evidence of front loading plus the evidence from quantum experiments like GHZ states plus the evidence from neuroscience like Libet.
Let's do science!
Comment by Thought Provoker — July 12, 2007 @ 3:21 pm
July 12th, 2007 at 4:22 pm
Hi TP,
Thanks for your invitation to join this discussion.
I hope you will continue with RogerRabbitt, Joy and John but I think I will interject a simple question here or there.
Can you describe some of the observations in the history of biological evolution which require your model for their explanation?
Comment by Pez — July 12, 2007 @ 4:22 pm
July 12th, 2007 at 5:01 pm
Hi Pez,
You asked…
The Third Choice presents some potential insight into the origin of coded information and, therefore, the origin of life itself.
I think Behe's history of malaria in Edge of Evolution supports the Third Choice.
Then there is Hameroff's interesting suggestion for the cause of the Cambrian Evolutionary Explosion.
link
I could expand on the Cambrian Evolutionary Explosion by talking about Vernanimalcula guizhouena if you are interested.
Just about any evidence supporting front loading supports the Third Choice.
Comment by Thought Provoker — July 12, 2007 @ 5:01 pm
July 12th, 2007 at 5:37 pm
TP:
Seems you've boiled things down to: 1. Actually random biological processes governed by semi-random selection (NDS). 2. Calvinistic predestination and deific front-loading. 3. Your version of pseudorandom ORCH-OR.
Though you've neglected a more EAM-related possibility that may be a fourth choice. Intentionality arising through quantum processes (that which employs and enjoys the benefits of (or suffers the drawbacks of inattention to) the massively parallel quantum computation going on in high-level specialized cellular processes.
Science would consider intent to be "random" on the level of their complete inability to predict what any individual may do or not do about anything. But sociologists and economists use probability just like quantum physicists do to make predictions for large groups and populations. And as biologists do when making predictions for populations as well. Diluting the individual events into a pool of raw data from which probabilities can be quantified 'works' pretty well for general purposes. But it has never said anything pertinent about what's real on the individual level. Which cannot reasonably be presumed "random" in reality.
It's not even pseudorandom, TP. That only pertains to large samples. It doesn't pertain to what's real for individual events.
Comment by Joy — July 12, 2007 @ 5:37 pm
July 12th, 2007 at 6:16 pm
Hi Joy,
I'm impressed you commented. I thought this thread may have gotten too long for your dial-up bandwidth.
You wrote…
Agreed. Nice summary, although "pseudorandom" isn't quite right but "so-interconnected-it-looks-random" is a little long.
I have no problems making room for an EAM-related possibility. I will even suggest it should come before the Third Choice (Choice 2.5?). At the risk of making a fool of myself, let me hazard a guess at our differences.
Where I am considering any "intentionality" (whether God or Mandelbrot Set) to be hidden behind non-deterministic "massively parallel quantum computation" you are suggesting a consciousness arising from this huge computer a kin to a cosmic artificial intelligence. Good so far?
If I understand correctly, then I take it this intelligence would be learning and adapting over billions of years, right?
I could live with this. However, wouldn't this be scientifically detectable?
Are you going to having me questioning my faith in NOMA, again?
Comment by Thought Provoker — July 12, 2007 @ 6:16 pm
July 12th, 2007 at 6:43 pm
TP:
It takes a few minutes, but this one's still shorter than the ones where keiths has been pitifully gladiating immaterial souls.
Not exactly, as "arising" suggests emergence. I'm more in line with Penrose on this one – it's fundamental, like gravity. Individual consciousness "arises" by virtue of its participation in the exercise of life, which is a focus (like a physical vortex) of this fundamental of the matrix.
Not necessarily. But it would aim for expression of itself, as do all fundamental parameters of the matrix. Like gravity, it might be an effect of a cause that isn't native to 3+1. And to a certain extent (depending on what the cause *is* in the totality of reality), the vortexes may get transported to that level upon completion of their concentration *in* 3+1.
Probably not any time soon. And of course depending on whether or not we can EVER reasonably quantify all the parameters effective here. What's beyond here is probably not quantifiable from here – causes of parameters that manifest only as effect.
Naw. There are some things we will never know for sure, and many things outside science's proper boundaries. What we can agree upon is allowance for beliefs about such things, without bigotry or violence.
Comment by Joy — July 12, 2007 @ 6:43 pm
July 12th, 2007 at 8:58 pm
Hi TP,
But does the origin of code and the origin of life require the Third Choice?
What about these makes you think your model is needed for an explanation?
Same question.
It seems you have an idea of a mechanism and you are in search of situations in which you can implicate it.
What evidence or data from biological evolution do you think is either unexplained without your model or is best explained by it?
And why?
Comment by Pez — July 12, 2007 @ 8:58 pm
July 12th, 2007 at 10:14 pm
Hi Pez,
You wrote…
Libet's half a second consciousness lag presents neuroscience with a puzzler for which Penrose-Hameroff provides an answer.
Dr. Dembski has calculated an Universal Probability Bound of between 10^120 to 10^150 to show the inadequacies of chance hypotheses for biological evolution based on a unorchestrated (undesigned) universe. This supports the need for something like Penrose-Hameroff Orchestrated Objective Reduction hypothesis.
The amount of information in the universe under Orch OR is exponentially more than under the unorchestrated view. This provides a better basis for explaining the information needs of the Origin of Life. The non-deterministic and non-random quantum effects is the potential source of coded-information. Thus providing both quantity and quality.
And there is also Hameroff's view of the origin of consciousness and its role in the Cambrian Evolutionary Explosion.
This is one choice out of four (if you include Joy's EAM).
Mainstream evolutionary thought represents the status quo. Most of the issues raised apply directly to the weaknesses of this status quo.
I am not sure what the mainstream ID mechanistic model is, other than omnipotent-intelligent-designer-did-it. But I suggest that isn't all that important since the other two choices are also ID hypotheses.
Joy's EAM and the Third Choice both appear to be variants of Penrose Orch OR.
I think EAM is more suggestive of a universal intelligence that aims "…for expression of itself, as do all fundamental parameters of the matrix."
The Third Choice is more suggestive of retrocausality with the Ultimate Cause remaining non-deterministic.
Which is these is the best contender to replace the status quo?
I am biased in that I think that should be based on the depth and quality of the mechanistic explanations for the available scientific evidence.
Comment by Thought Provoker — July 12, 2007 @ 10:14 pm
July 13th, 2007 at 12:15 am
Hi TP,
I think you are trying here, but you aren't addressing my question.
It is, again:
You've mentioned that Dembski has theorized a probability bound of about 1 in 10^150 (approximately all of the events in all of the history of the universe) to eliminate the efficacy of the chance hypothesis.
But to what are you applying it? You say "to show the inadequacies of chance hypotheses for biological evolution ", but what, specifically, are you talking about? Dembski never said "evolution by chance is less probable than 1 in 10^150".
How so?
What quantity of coded-information is needed for abiogenesis, how is this provided by "non-deterministic and non-random quantum effects" and why is it provided only by "non-deterministic and non-random quantum effects"
What is the role of consciousness in the Cambrian explosion, what is the source of consciousness, and why is it necessary?
So you accept the weakness of the model of the status quo, but what I've been asking is what evidences this weakness in your mind?
Comment by Pez — July 13, 2007 @ 12:15 am
July 13th, 2007 at 1:00 am
Hi Pez,
You asked again…
If you ask the same question in the same manner I will give you the same answer.
The data from Libet's consciousness experiments are unexplained without Penrose-Hameroff or some other new model.
The same goes for the other examples I gave.
biological evolution
I think he came pretty close to that in this paper
I don't know whether information quantity or quality is needed. I refer you to Bradford's and Eric's comments on why they insist that a source of coded-information is needed. The Third Choice offers a possible source if it is truly needed.
That is explained here.
And I have been telling you.
1. Libet.
2. OOL
3. Cambrian explosion
4. Behe's evolution of malaria
5. General evidence of front loading/retrocausality
Here are some more…
Behe's Cillia (lot's of microtubules)
Neurons and consciousness (even more microtubules)
Comment by Thought Provoker — July 13, 2007 @ 1:00 am
July 13th, 2007 at 2:26 am
Hi TP,
You have given no answer.
This is still a non answer.
"Biological evolution" is not a feature or event of biological evolution. Dembski does not say "biological evolution" is improbable. He selects features and applies his probability analysis to them individually (but not in the paper you cite).
That PDF of a paper by Dembski I've perused on several occasions. Can you give any data, or a quotation, even, that supports your blanket application of his probability bound to 'biological evolution' as a general thesis? What is it that you are observing to fall within a rejection region?
While I am certainly gratified that you recognize and value Dembski's work you are citing it in a manner that has absolutely nothing to do with his paper.
What do you see in the history of biological evolution which is not explained by what you refer to as 'the status quo'?
Do you accept Behe's and Dembski's arguments about the flagella? Do you accept Behe's (as you seem to at the end) design inference with regards to cilia?
It's your model – can't you tell me why you think an information input is necessary and why your model is particularly suited to explaining it? If the source of information is not truly needed then why do you invoke your model?
And what is the source in your model of this information?
I read your link the first time as well as the excerpts you placed on another thread. I don't find my answer. Can you not explain yourself at all?
You've been bragging to me for a couple weeks about the detail of your model. Can you not give me some?
"Libet" is not detail. This is one possible application of retrocausality via quantum events. It is explained by others in other ways and I fail to see how it is a failure of the 'status quo'. And even if this is evidence that your model applies you are not providing evidence that it applies elsewhere or ought to be generalized to affect all of life or the conditions for life.
You have not explained how OOL or the Cambrian explosion pose problems for the status quo nor why your model is uniquely supported by them.
"Behe's evolution of malaria"
What does this have to do with your model in any way shape or form?
How does this support your ideas?
"Behe's cilia"
You are pointing now at the existence of microtubules as problems for the status quo and as evidence for your model?
This doesn't make any sense.
You've repeatedly invited/challenged me to come here and ask my questions and engage in discussion but you don't want to answer the questions and rather than discuss you want me to go away and reformulate your model for myself.
Is this what you mean when you say you are doing science on this thread?
[edit]
ps.
As I might forget later, this is a reminder to me to discuss the logic of the designing aliens in Dembski's paper once and if you and I resolve anything on these other questions.
Comment by Pez — July 13, 2007 @ 2:26 am
July 13th, 2007 at 7:23 am
RogerRabbit wrote:
Hi Roger, I wanted to get back to you earlier but I have been a little pressed for time lately.
I've spent considerable amount of time recently both on this thread and an earlier one trying comprehend what TP is trying to argue for here. My main interest is the current research that is being done in the field of consciousness studies and I was interested as to how and how well a model based on quantum mechanical effects could perhaps help explain consciousness. I have concluded after reading some papers by Hammeroff, Penrose and Hammeroff, sections from two of Penrose's books, as well as criticisms from numerous other scholars and writers, that while it is entirely possible that QM has something to do with sentient consciousness the ORCH-OR model, at least, does not do a good job of explaining how it does. In my opinion neither Penrose, Hammeroff or TP really understand the problem: how do you objectively (or empirically) study something that is by it's very nature subjective? Or, how does one prove that when one has discovered what one believes to be the underlying cause consciousness that it is indeed consciousness that is being caused? Researchers run into similar problems when trying to explain what kind of conscious thoughts higher species (non-human) of animal's experience. How does one access conscious thoughts that are by nature personal, private and subjective? It is my opinion that introducing some speculative ideas about QM explains little to nothing. However, that is not to say that nothing could ever come of a QM based model: but at this point in my opinion QM models like the Penrose-Hammeroff ORCH-OR model is little more that speculation.
I've become actually more curious as to why TP has become so excited about it. It "˜s made me a little suspicious. Maybe he's just pulling our collective leg's. I still keep thinking that he is a friend of Alan Sokal.
Comment by JOHN_A_DESIGNER — July 13, 2007 @ 7:23 am
July 13th, 2007 at 11:55 am
John_A to Roger Rabbit:
Hi, John. From what I've been able to gather (as the 'unindicted co-conspirator' here), if TP isn't pulling our legs – or mostly just mine – he's unsatisfied with NDS pablum because it really doesn't explain life or evolution sufficiently, has begun to suspect things are quite a bit less than random, and is trying hard to come up with something that might explain the non-randomness without having to consider the existence of consciousness/intelligence that qualifies as 'greater-than' human, due to a priori metaphysical commitments.
It is my understanding that the explorations of quantum models for consciousness (there are more than Orch-OR) are specific to the substantially AI-funded "quest for consciousness" ongoing for the past few decades. So perhaps looking at the issue from that POV is helpful for your concerns.
Of course you probably know that computer sciences have pretty much cornered the money market on the applications end of science for a bit over a quarter century now, particularly since the technologies went public in the wake of the Soviet demise. The theory and materials research was primarily gub-military sponsored before that, with only some minor ap's eventually finding their way into the grocery store checkout line about 20 years behind development (digital watches, pocket calculators). Since going public the advances have been fast and furious, resulting in our mini-supercomputers and peripherals being obsolete the moment we buy them.
The 'computer revolution' has produced a bunch of the richest guys on the planet who really don't have all that many good places to hide all that wealth. I mean, you can only own so many third world countries in this game of Risk before some first world gub'ment decides you should pay taxes like the rest of us. So some of them decided to invest in their transhumanist dreams, and we get the info-rich, multi-pub'ed race toward nanotechnology and quantum computers. Mostly unspoken underlying desire: conscious machines.
Now, it's possible right now with a few in-line G-5s to simulate a human for purposes of competition in the annual 'Turing Prize' competition. A 'bot that could convince almost anyone it's a real person posting to some blog or message board or user group. I might be one. So might TP. Or you, or Roger, or even Mike Gene. But the programmer would of course know it's not actually conscious, though humans and even scientists have no real handle on what consciousness *is* or how it works. Thus the 'quest'.
There's a lot of money going into it. Entire university departments have been funded, and chairs established just for the exercise. Scientists, medical researchers and technicians of wide ranging specialties all over the world are involved. Researchers have a new source of funding, and are going for it. The quantum angle is 'important' to their dream, thus they need a basic grasp of mechanism on that level and some means of control so that what comes out at the end of the time-less computations isn't random.
At this point in the quest answers to these questions aren't necessary. What's necessary is mechanism and theory toward what it's doing. Perhaps as the physical technology for quantum nanocomputers develops, a black box will one day soon tell its creator it's 'alive' and conscious. At which point quantification of those details will become necessary. All this is developing in parallel right now on a number of fronts. No need to jump ahead of ourselves while the nitty-gritty is being invented.
As it must be. The NOMA distinctions – and the question of whether or not they exist at all – is still very much up in the air. The AI-guys have wisely included philosophers of science and even theologians from a number of traditions in the quest. They know that whatever the answers are, if they're positive it will have significant impact on humanity in general and metaphysics in particular. Penrose, Stapp and others at the forefront of the theoretics know they will not live long enough to see the answers. Some have died already. So they're just laying out the physical speculatives, for another generation to formalize when that becomes necessary.
That's long-winded, but I hope it has addressed some of your concerns. No one arguing the pros or cons of ID vs. NDS need concern themselves about this stuff at this point. The science will work itself out according to the evidence eventually. NDS will fall, and what takes its place will look quite a bit like some version of ID. With consciousness as the operator rather than gods/God, so beliefs about such entities will remain immune from empirical intrusion. My prediction, having followed the quest quite closely for a decade or more.
I could of course be wrong (along with everyone else). Time will tell.
Comment by Joy — July 13, 2007 @ 11:55 am
July 13th, 2007 at 1:19 pm
Hi All,
You can thank Joy for the reason this comment is a lot less provocative than the one I had been thinking to composing. Her answer was pretty much on target (as usual).
Joy wrote…
Even I don't know is I am pulling your leg or not. I suggest it doesn't matter because the last thing I want is for people to passively agree with me. Whether I am just a troll or truly trying to provoke thinking the arguments and logic stand on their own.
I am not asking for anything I'm not imposing on myself. There are many things that I have uncovered during this investigation that I am uncomfortable with. For example, Sobottka's treatment of this still bothers me.
John wrote…
I have heard the name Sokal before, but I don't know who he is or the details of his history. John's suspicions are understandable and expected. However, if this has all been a hoax, I suggest it is a good one. Do you really think I am THAT good?
(I'm still waiting for Joy to pull the rug out from under me because I'm afraid she might be that good.)
For what it is worth, I have posted the Penrose-Hameroff model on three other web sites run by ID critics (PZ Myers, Ed Brayton and Mocost) the response was decidedly negative. I was banned from Mocost's blog because my comments were irrelevant. I was somewhat surprised that a potential consciousness model would be considered irrelevant to a blog titled Neurophilosophy set up for the purpose of discussing neuroscience.
Pez has asked me to provide evidence that supports this model. I provided a list with a brief description of each to which Pez responds with"¦
And
And
And
This reminds me of Behe being presented multiple papers and books during the Dover trial and still maintaining they didn't provide answers.
Even so, I welcome the opportunaty to compile a comprehensive list of scientific evidence this weekend and post it. A lot of it will come from one of my more favorite scientist sources, MikeGene's blog.
Comment by Thought Provoker — July 13, 2007 @ 1:19 pm
July 13th, 2007 at 1:30 pm
Hi TP,
Me too!
His questions weren't answered either. Like me, he was presented with lots of literature which didn't address the problems he raised.
We have come a long way to find another point of agreement.
(you were just shield-bashing, right? I thought so.)
I look forward to your comprehensive list, but couldn't you answer just one question in the interim?
It seems to be true, as I've attempted to clarify, and as Joy has inferred, that you are "unsatisfied with the NDS pablum".
If it's true then ought it not fall regardless of whether or not you have a detailed, mechanistic, naturalistic model with which to replace it?
Comment by Pez — July 13, 2007 @ 1:30 pm
July 13th, 2007 at 3:40 pm
TP:
You'll find as much in-fighting and as many self-possessed turf warriors in consciousness studies (and all fields attached) as anywhere else. Maybe even particularly on the physics level. Everybody's got their favorite speculative model, some don't believe any of it (i.e., the Churchlands, et al., who look to be involved solely to nay-say the whole enterprise and are NOT being paid by the AI-guys), and some who are flat-out jealous as hell that someone with Penrose's clout would dare to insert himself. They'd automatically hate ANYTHING he has to say about any of it.
I find the Penrose story quite fascinating, myself. It's quite the family tradition to be overly brilliant and mathematically impossible. Sir Roger's older brother Oliver was a professor of mathematics in Edinburgh, younger brother Jonathan was British Chess Champion ten times, possibly the most talented chessmaster of all time and a talented game theorist. Their father Lionel was a psychologist and geneticist, mother Margaret dabbled in recreational mathematics and geometry. This sort of personal history could tell you a lot about why someone like Roger would "relax" by playing with tilings when he's not contemplating singularities and their outrageous implications. Or just play chess. He's in his 70s now. He's leaving a legacy to the ages, because he's more than earned that right, having been knighted for his many contributions to science (despite never having won a Nobel).
…so I'm often put off by the wannabes who believe they're man enough to challenge him. You do know the joke about mathematicians and God, don't you? §;o) At any rate, I admire his attempt to leave something to this quest for consciousness he'll never see the end of. Besides, he's actually a really charming gentleman in an age when gentlemen are often derided unmercifully by wannabe punks. Stu (Hameroff) delightedly discovered this about him as well, thankfully for the science of consciousness.
I expect that somewhere way down the road when we're all just notations in some distant descendants' family Bible, he will be vindicated rather spectacularly. As Liebniz was despite Newton's horrendous and extremely nasty vendetta against the man from whom he stole Calculus. A prediction, which maybe my great-grandchildren will see made good. Sometimes you just have to bet on a horse. Even if you can't stay around for the finish of the race.
Comment by Joy — July 13, 2007 @ 3:40 pm
July 13th, 2007 at 4:04 pm
Hi Pez,
You asked…
The short answer is "no".
The status quo stays in place until something better is offered. It has been noted before that science is constantly in transition. Aristotle to Newton to Einstein to ????.
For many years scientists knew something was wrong with their models. We knew the earth was old but no chemical reaction could explain how our sun could be older than the earth (until E=MC^2). Science does the best it can with the mechanistic models it has until a new one comes along.
Comment by Thought Provoker — July 13, 2007 @ 4:04 pm
July 13th, 2007 at 4:28 pm
Hi TP,
The short answer is wrong.
Did you consider the question Dembski asks concerning the aliens in the paper you linked?
It deals with the situation you find yourself in, but through a thought experiment designed to answer the question "how can we infer design without independent knowledge of the designer?":
Thus my questions to you about OOL, the Cambrian Explosion, the flagellum, etc.
If it is true, as you attest, that the 'status quo' cannot explain the evidence then that is the fact you first have to deal with.
This is a fact with or without your preferred 'mechanistic model'.
My next question is this. Did you accept that the 'status quo' was a failure, based upon the evidence you now cite (including the work of Dembski and Behe), which would have been intellectually honest, and then set out to find a mechanism?
Or did you accept the failed 'status quo' position, in spite of the evidence, until you found a model which could fit into your worldview?
You have essentially accepted the evidence because you have met the aliens.
But the evidence tells the story, aliens or no.
Additionally, the alien-theory is underdetermined by the evidence, but just finds compatibility with it. So far your presentation of your model suffers from the same underdetermination.
As per ID, all that seems to be justifiably inferred from the evidence you cite is Design, not your mechanism.
Comment by Pez — July 13, 2007 @ 4:28 pm
July 13th, 2007 at 4:56 pm
Hi Pez,
You appear to be an all-or-nothing type person. Ergo, only an all-or-nothing hypothesis will satisfy you.
That is fine for a metaphysical concept, but this is science.
Science is always wrong about something. It is always incomplete. However, we continue to make mechanistic models in order to do even more science.
Would it help to think of it as a game or a puzzle with rules? I believe the science game can never end and there will be no winner because of NOMA.
In this game, a mechanistic model remains king-of-the-hill until a bigger, better mechanistic model come along.
Comment by Thought Provoker — July 13, 2007 @ 4:56 pm
July 13th, 2007 at 5:20 pm
Hi TP,
Do I? Please explain.
To me I appear to be quite the opposite.
So you say.
But then why is it you are so eager to address my short-comings, dueling metaphysics, and the philosophical notions of demarcation and yet avoid all my empirical questions about your model?
Yes, I very much think of Science TM and your demarcation efforts as a game.
But no mechanistic model has verified the game or its rules.
Nonetheless, you are avoiding questions and changing the subject yet again.
How do you answer the alien analogy and my follow-up questions?
With nothing more than "if you don't pass Go you don't collect $200"
So you accept an obviously false and failed paradigm which doesn't reflect reality just because it is king-of-the-hill?
And yet the very evidence you ruled out of court as non-scientific you use to bolster your own argument.
Comment by Pez — July 13, 2007 @ 5:20 pm
July 14th, 2007 at 4:58 am
Hi Pez,
I don't consider your metaphysics and philosophical notions "short-comings".
You have asked me some questions, I have answered them. You don't like the answers (no surprise).
When I offered to compile a more comprehensive list this weekend, you requested I "…answer just one question in the interim". The question was philosophical in nature (as in Philosophy of Science) but I answered it.
You didn't like the answer (again, no surprise).
Then you went off on a tangent subject concerning a hypothetical situation of a visitation from advanced aliens. I made an observation based on your comment.
You disagree with my observation (once again, no surprise).
I didn't directly respond to your hypothetical for a couple of reasons. First, I am busy putting together a list of examples for you to reject. Second, I have dealt with the ETI issue before and the hypothetical doesn't need to be as complicated as you made it. The ETI doesn't have to actually visit and doesn't even have to demonstrate superiority. If the SETI program is in anyway successful, I have little doubt there will be people who will immediately start worshipping the new found intelligence. Also, the scientific hypothesis that the earth was seeded will move up a notch in viability.
Focus, Pez, focus. This thread is about comparing various mechanistic models to the Third Choice. While one model is momentarily King-of-the-hill, it doesn't mean all other models are null and void. Science is in a constant state of flux. New evidence helps some models and hurts others. No one model gets exclusive rights to any evidence.
Dueling metaphysics is where we deal with ultimate Truths, not science. Philosophical questions are distracting. However, I will tell you what. I will give you an opportunity to engage in a philosophical discussion with me in another thread when I respond to something stunney said. Ok?
Comment by Thought Provoker — July 14, 2007 @ 4:58 am
July 14th, 2007 at 5:41 am
Hi TP,
You make me laugh everytime you ask me to focus. You can't answer a single question in context and you run off in every direction to avoid doing so. And yet I am the one who has to focus.
===
I hope your compilation will answer the first question I asked of you (although by now it is quite unnecessary and the point is all too evident):
You've mentioned brain processes, which do not qualify.
You've pointed me to the fact that Dembski has an opinion on the failure of the status quo, but haven't told me how, where or why you may or may not share his opinion.
You've mentioned Behe and malaria, but I can't see how this is supposed to evidence retro-causality in any way.
You mention that Behe has written about structures composed of MT, but don't mention any way that this evidences your model.
What else, oh yes, OOL. You don't even know if there is a requirement for an information input for abiogenesis to take place but you say, if there is, then your model can supply it. You don't say how, of course.
So, tell you what, let's see what happens there before you direct me to yet another thread for more of your obfuscation.
===
As yet another example observe your treatment of the thought experiment.
You can't even tell that the point wasn't about ETI but about the evidence for the 'status quo' and your acceptance/rejection of it (and I didn't make the thought experiment too complicated, I lifted it directly out of the Dembski paper which you erroneously cited). You accept the evidence that ND fails (but haven't shown any yet) although somehow this obvious failure is not enough for you to reject that paradigm. The big tipping event for you is whether or not you have found something else to replace it which fits the rules of your game – this shows the irrelevance of your rules.
You go from thread to thread challenging Behe's positions (which challenge you offer usually after failing to smear him with your misrepresentations – Truman Show and Demons) but then use him and Dembski to refute ND and lend support to a model you prefer.
You accept their work and theories as true (not True) and relevant but dismiss them as not admissible on their own merits because you don't like the naked implications. By your reference you admit that ND fails and you validate the design inference (without knowledge of designer and without mechanism). But you posture that you have something superior when all you have is something extra.
They have demonstrated to your satisfaction that the status quo is a loser and that Design is the answer. With that in hand you have gathered some ideas for how that design could have been realized and then act like you have something that challenges their positions. You don't. You rely upon theirs to justify your own.
Comment by Pez — July 14, 2007 @ 5:41 am
July 14th, 2007 at 7:13 am
Thought Provoker Says:
Hmmmm. I post that I don't understand it, and would like a brief explanation of the concept and it's relevance, and you think it is a "compliment" to tell me I do understand and just don't like it. Not in my world, but they assure me that diversity is a wonderful thing, so I guess I shouldn't complain.
And you probably think Behe is supporting your position, but I think he supports the claim I made. Randomness vs design is NOT the same as randomness vs pseudo-randomness. It is in one sense a minor point, but it is reasonably critical in understanding the topic, and if we can't seem to resolve what is meant by some of the terms, further discussion doesn't have much of a chance at fruitfulness.
As for your rules, you are free to hold them personally, but they don't obligate anybody else to accept them. Newton's Law of Gravity wasn't a mechanistic model, in the sense that he offered no mechanism for how it worked. He thought that maybe it was God doing the heavy lifting there. But it was considered an important theory of science, and still is, even after being fasified. Mechanistic models that can be demonstrated to work can be useful in persuading others. But that isn't the kind of model you've given us. Somehow you seem to think that the mere offering of what you term a mechanistic model with no evidence (nor even much of an explanation) trumps other concepts and makes you "scientific" and others not.
Sorry, but I don't buy that. If that is your personal line of demarcation, that's OK with me. But I don't think it will impress others. If you don't want your "science" to be a popularity contest, I think the good news for you is that you don't have to worry about winning it any popularity awards.
Comment by RogerRabbitt — July 14, 2007 @ 7:13 am
July 14th, 2007 at 7:27 am
Joy says:
There's nothing about ID in general that requires "consciousness/intelligence that qualifies as 'greater-than' human". It might require knowledge that we humans do not yet hold, and it may turn out in the long run that there are things happening that we cannot do, but the science isn't at that point yet.
The problem I have with that description of TP's position, is this:
The telic universe and/or God, would seem to qualify as "greater than human", and seems to be an a priori metaphysical commitment that TP holds, and finds necessary to his "model". TP seems to be chasing his tail, and not doing a very good job of it.
Comment by RogerRabbitt — July 14, 2007 @ 7:27 am
July 14th, 2007 at 9:12 am
Hi Pez,
You wrote…
hmmm
I am a little disappointed that you think it is "quite unnecessary". After all, you have challenged me and I like challenges. Especially if it provokes thinking in myself and others.
But since you have decided to start explaining your reasons for being dissatisfied with my previous answers, I will expound on them rather than engage in a data dump.
I believe Libet and other consciousness experiments qualify on multiple levels.
First, as much as you might like to restrict scientific research into your chosen areas of study, Joy makes a very good point when she indicates that is a weakness of a lot of scientists although she tends to focus this criticism on biologists. A mechanistic model that explains biological processes but is inconsistent with other scientific fields is a very weak model.
I gave you the example of how scientists studying the sun had a model that was totally incompatible with geologists. It is easy to use 20/20 hind sight to know which one was wrong, but this is a lesson for us now. A good model needs to be more holistic of multiple disciplines.
Another reason this directly qualifies is that neural activity is very much applicable to the evolution of life on Earth. One of my favorite ID Scientists, MikeGene, provided a link that included the scientific data point that "It is likely that [two types of hormone-secreting nerve cells] existed already in Urbilateria, the last common ancestors of vertebrates, insects and worms"
While the Urbilateria is a hypothetical organism, the Vernanimalcula guizhouena is not. This is all pre-Cambrian. Regardless of your metaphysical stance on what make human thought distinct from animal thought, animals do think. I suggest the Vernanimalcula guizhouena may represent one of the first conscious organisms that could see, touch, taste and smell (hearing came later).
Another important qualifier is that the Libet's experimental data supports how retrocausality is directly exhibited by biological organisms. The Orch OR hypothesis is that we start the decision making process before the cause for the decision.
Extraordinary claims need extraordinary evidence. I suggest Libet, GHZ State and other quantum experiments provide plenty of extraordinary evidence that retrocausality is real.
You have totally missed the point of where I am coming from if you think I am using Dembski as an authoritative source. I have pushed the suggestion that we should all think for ourselves. I think we need to understand why and how hypotheses work before accepting them. Personally, I can't accept a non-mechanistic model because I can't understand it. There is no "how" to a non-mechanistic model. I make an exception for omnipotent beings like God or omnipotent Intelligent Designers. But that is a compromise due to the inherent nature of omnipotence.
What Dembski did in chapter 7 in this link was provide a way to compare various chance hypotheses for a specific event by calculating specified complexities using the following formula…
χ = "“log2[ 10^120 "¢ Ï•S(T)"¢P(T|H)].
Where 10^120 being "…the maximal number of bit operations that the known,
observable universe could have performed throughout its entire multi-billion year history."
This assumes that the bit operations are actually random and not interconnected. Under Orch OR, the term is exponentially bigger, as in taking 10^120 and raising it to the power of 10^120. This is not a Many World effect, it is the interconnected effect.
Comparing a simple chance hypothesis to Orch OR is a phenomenal mismatch. If Orch OR can be shown to be possible, it becomes a practical certainty against simple chance hypotheses.
Other evidence provides better direct support for retrocausality. Behe's evidence is more supportive of the orchestration part of Orch OR. However, it does support retrocausality indirectly by suggesting a possibility of front loading.
Behe lends support of orchestration by offering evidence that natural randomness may not be an adequate explanation with the history of malaria being one example. He also posits that orchestration/design occurs at the molecular level. IWO, at a level that is directly subject to quantum level effects. Here is something Behe recently said on this…
"In The Edge of Evolution, and in Darwin's Black Box before it, I strongly emphasized that modern biology shows us that life is built upon intricate molecular systems, and that to understand the limits of random mutation and thus Darwin's theory, we have to concentrate our attention on the molecular level. … In The Edge of Evolution I argued that some biological levels (down to vertebrate class) could not be explained by Darwinism, but I based my argument entirely on advances in our knowledge of the complexity of the molecular developmental systems underpinning them." [emphasis mine]
The Penrose-Hameroff conciousness model lives or dies on microtubules. Microtubules and like DNA to consciousness. If there are no microtubules, there is no consciousness. Microtubules are the link to the interconnected quantum world. I understand Behe's EoE, page 94 contains…
"IFT exponetially increases the difficulty of explaining the irreducibly complex cilium. It is clear from careful experimental work with all ciliated cells that have been examined, from alga to mice, that a functioning cilium requires a working IFT.12 The problem of the origin of the cilium is now intimately connected to the problem of the origin of IFT. Before its discovery we could be forgiven for overlooking the problem of how a cilium was built. Biologists could vaguely wave off the problem, knowing that some proteins fold by themselves and associate in the cell without help. Just as a century ago Haeckel thought it would be easy for life to originate, a few decades ago one could have been excused for thinking it was probably easy to put a cilium together; the piece could probably just glom together on their own. But now that the elegant complexity of IFT has been uncovered, we can ignore the question no longer."
IFT stands for "Intraflagellar Transport" a "…process essential for the formation and maintenance of eukaryotic cilia and flagella".
Here is a link showing how the microtubule is essential and central to the process.
Here is a link showing how the microtubule is essential and central to neuron function.
I admit, I got lazy here. And I will give it a short mention again because no other model provides a better explanation. By comparison, the Third Choice is attractive because of the quantity and quality of the information available.
As to how, here is a quick link showing how RNA and DNA are a mini quantum computers.
A telic universe, forced to be consistent with itself, could use quantum effects to create simple, self replicating quantum computers that eventually caused microtubules to be formed that eventually caused humans to think.
Why does the telic universe need thinking humans? That is definitely a metaphysical question but humans could be needed to bring an orderly end to the universe.
Comment by Thought Provoker — July 14, 2007 @ 9:12 am
July 14th, 2007 at 10:31 am
Hi RodgerRabbitt,
You wrote…
Scientific evidence and sound logic isn't owned by the person presenting it. It matters little if Behe would support my position or not. It is all part and parcel with thinking for oneself.
I am all for obtaining a mutual definition of terms. Especially the terms "intelligence" and "design". I was wondering when someone was going to argue the definition of design. Thank You for doing so. To me, "design" is a property of non-random purposefulness.
The Third Choice posits that there is no such thing as randomness and the purpose of whatever metaphysical process/being is behind all of this is for the universe to be consistent.
However, before I irritate you any further, I will wait to hear your suggested definition.
Maybe I am using the term "mechanistic" incorrectly then. Because I consider Newton's Law of Gravity to be a mechanistic model. It is consistent with itself and is something that I can, and have, tested experimentally. Penrose is a mathematician. He has suggesting a very detailed mathematical model for the universe. F=ma was a mathematical model. Penrose's Twistor and OR model combine to make a significant extension of Newton's model, but it is an extension.
The Penrose-Hameroff consciousness model is an extension of this. It goes beyond pure mathematics. It would be similar to the historical hypothesis that the sun was nuclear powered or that DNA is the basis for genetics for like on Earth. But its basis is a natural extension of Penrose's mathematical model.
I have only given a very brief summary of the model. You would need to read and comprehend Penrose's Road to Reality to fully appreciate his mathematical model.
Hameroff has a lot of information at his web site http://www.hameroff.com.
I have tried my best to present the highlights of all of this. I am sorry if it was not good enough.
I have begged and pleaded for others to offer and present other models.
Joy's EAM is another model. She and I are discussing the differences between them.
Salvador T. Cordova has occasionally discussed his thoughts on a YEC model with me. He has semi-invited me for further discussions on his new blog. I am waiting for an appropriate time to do so.
I understand not everyone likes my adversarial way of exploring proposals, but I offer that I am more helpful than hurtful in getting people to think about what they are proposing.
Comment by Thought Provoker — July 14, 2007 @ 10:31 am
July 14th, 2007 at 12:21 pm
Hi TP,
Talk about pseudo-random weirdness…
I was preparing to fend off another of your accusations of merely repeating myself and here you claim I've just now decided to explain myself. Oh well, you do keep things interesting…
I'm not limiting anything. You said that the history of biological evolution provided evidence for your Third Choice. When I asked you how you point to potential explanations for brain-state experiments.
Yes, I accept that you think brains evolved, but that doesn't make references to brains and neurological activity evidence from evolution.
This is your real point here, and the real evidence you are garnering from this experiment. Never mind that it is your interpretation that retro-causality is the explanation here, that retro-causality is the explanation for the history of life on earth, and that this is extraordinary evidence, but this does not make it evidence from the history of biological evolution.
At best you are showing that, given the assumption that your Third Choice is right, this demonstrates one level of consistency.
I think you are ("were" – now, as you are back-tracking) using Dembski in the manner you said you were.
I asked…
And you answered…
Yes, we know where Dembski has set his UPB. And then you used this as evidence that your Third Choice was necessary.
So, on one hand you accept his criteria but you never demonstrate even one way in which it is applicable or stands as evidence in your case.
On the other hand you now say …
… as though to demonstrate that Dembski's UPB has no bearing upon your model. All you are saying now is that your model provides a far greater resource field – as though to demonstrate that your model is a chance-driven model after-all.
You don't know what you want to claim or what you consider to be evidence of your model.
Good. My original question.
How do you see this as evidence for front-loading?
How do you see evidence of front-loading as evidence for your model?
Why do you accept Behe's argument here and then go to other threads and act like he has failed to justify his design inference through his scientific investigation?
Golly, but so what?
Yes, Behe talks about microtubules and your model requires them.
It's not like we needed Behe to tell us that they existed. He does not support your model by discussing them, or their function in structures that he calls IC, or the complexity of their formation, or the difficulty of explaining their origin.
The fact that they are interesting, nearly ubiquitous, and extremely complex doesn't provide evidence from the history of biological evidence for your model.
Again, all you are doing is showing possible internal consistency.
What you are really trying to do now is soft-shoe the fact that you accept the arguments of Behe and Dembski as refuting the status quo and of evidencing design,.
Again, WHY do you think the status quo fails? WHY do you think your model is the best?
All you are doing is showing that there is some consistency – if one accepts your model in the first place.
Oh, and speaking of "consistency", you are smuggling in more metaphysics there – why is a telic universe "forced to be consistent with itself"
How does this universe "create" and "use" quantum effects?
And your link does not "show[] how RNA and DNA are mini quantum computers" – it hypothesizes that they might be. Your science is sloppy, and, as you said above, lazy, and as you demonstrate on Dembski and Behe, selective and inconsistent.
Just trying to help you think.
Comment by Pez — July 14, 2007 @ 12:21 pm
July 14th, 2007 at 1:23 pm
Hi Pez,
About the applicability of Libet's experiment, I wrote…
"Another reason this directly qualifies is that neural activity is very much applicable to the evolution of life on Earth."
We are back to denying everything. Making reference to the fact that today exists does provide evidence the yesterday existed.
Then there is the hypothesis that consciousness sparked the Cambrian Evolutionary Explosion
You also totally ignored the cute and capable Vernanimalcula guizhouena
This little critter is evidence of front loading and conciousness.
I wrote… "I suggest Libet, GHZ State and other quantum experiments provide plenty of extraordinary evidence that retrocausality is real."
You responded with…
Plus the fact there is no other model than comes close to explaining this.
Focus, Pez, focus. We are COMPARING models. This is one choice out of many.
Earlier, you indicated you were not limiting anything, then don't limit evidence has having to be "…from the history of biological evolution."
The UPB has quite a bit bearing when comparing models to random chance.
Focus, Pez, focus. We are COMPARING models. This is one choice out of many.
One of the properities of Dembski's implied model is that it ended up forcing a perfect design. No chance for error. If the Intellegent Designer is fallible, there is a chance for error, thus it becomes a chance hypothesis.
An omnipotent intelligent designer gets around that, but it isn't clear that is what is being proposed by anyone other than Salvador and other Creationists. In Salvador's model, the designer is God.
The Third Choice isn't a neccesarily a chance hypothesis. There could be a perfect designer pulling the strings. But that doesn't have to be the case and we may never know which is the Ultimate Truth.
Front-loading implies a predictive process. It is either planned or retrocasual.
You still don't see how I am looking for models to compare with?
Focus, Pez, focus. We are COMPARING models. This is one choice out of many. Would you like to present Behe's or your model now?
Family duty calls. I have to run.
Will finish up about microtubules later.
Comment by Thought Provoker — July 14, 2007 @ 1:23 pm
July 14th, 2007 at 2:20 pm
Hi TP,
What's this supposed to mean. With whom have you confused me that you think we have a history of my denying everything? Silly, TP. Yes, the fact that today exists provides evidence that yesterday existed. But hypopthesizing that because we have brains that might evidence retrocausality via QM does not provide evidence that QM and retrocausality played any role in the evolution of these brains. You are pointing to a modern feature and claiming that your model best explains it. Fine.
But then you are trying to use that feature and your explanation and saying this is evidenced by past evolution. There is no correlation between the observation (precognitive brain activity) and the claim (retrocausation of biological evolution).
Focus, TP, focus.
HOW is this evidence of front-loading? To start with you even have to infer that Cambrian organisms were somehow conscious, before you can even infer that this consciousness somehow guided evolution.
At the end you address how you think evidence for front-loading is evidence for your model:
First you have to demonstrate how you think front-loading is implied. Then you have to show how retrocausality could account for it. Please do these things. You hypothesize that there is such a thing as retrocausality. You hypothesize that it could frontload evolution. You hypothesize that there is such a thing as frontloaded evolution. All you are doing is stringing hypotheses together. Where is the detail you bragged about over and over again?
Focus, TP, focus. You invoked evidence from Behe and his treatment of biological evolution as support for your model.
To ascertain why you were doing this I asked:
If you didn't want to answer, or couldn't, you could have just said so. Instead you have thrown up smokescreen after smokescreen.
You keep suggesting Libet's experiments (which you claim only your model can explain) and somehow try to implicate these in the evolution of life on this planet. Just show me how this is supposed to preferentially favour your model.
I can say that I have big feet, and that I must have them because of evolution. This does nothing to explain why big feet are evidence of evolution, or any particular model of it, or how they are best explained by one model or another, or how big feet might have affected evolution.
It is your model. It is your job to connect the dots.
Focus, TP, focus. HOW does the UPB have any bearing? Demonstrate something. Support your model. Don't just point to the fact that Dembski has come up with it – show how and where it applies. In one breath you say Dembski is not an authority and in the next you cite him as having some unknown, undisclosed bearing upon your case.
This is unsupported gobbledegook. Not only can you not demonstrate this but it has no bearing upon your use of Dembski.
Focus, TP, focus.
You bragged about your details. Let's see them.
So far all I've seen is that you accept everything about the design inferences – Mike Gene's front-loading, Behe's IC and EoE, and Dembski's UPB, their arguments against NDS – and claim all of these supports are somehow inferior to "your" idea – even though you rely upon each one in lieu of having your own details. But all your idea is is vague speculation about QM and microtubules and how this could have acted as a vehicle for the implicated design.
You may think that I am arguing against your model, but you would be wrong. I am arguing against you. You mock and challenge that nobody has a 'model' the equivalent of yours when all you have is an idea about how their models were realized.
In so doing you cut them off at the knees by invoking (after accepting their facts) rules of demarcation to claim that they have no models. You win by your own definition without providing a bit of the detail you claim you have.
If you want to play football while others are playing hockey it makes no sense for you to come along and say their game of football is inferior to yours.
Comment by Pez — July 14, 2007 @ 2:20 pm
July 14th, 2007 at 3:08 pm
RogerRabbit:
Actually, telic design *of* life does require the existence of a designing intelligence of some definition adequate to account for telic design. Once such design is instantiated – and concentrated consciousness reaches its expressive threshold – telic design *in* life can be explained from there by life itself. IMO.
We know for a plain fact that we weren't around when life began on this planet or any other. We also know we don't have the knowledge or the talent to create life outside our normal reproductive proclivities – life from life (though that's enough). Worse, we know by scientific examination that life does not spontaneously generate from inorganic or organic matter anywhere on this planet at any time under any circumstances natural or unnatural. It just doesn't happen, there is no sound scientific reason at all to assume such a thing is even possible, much less ever happened. Unless you believe a Reb can create a golem to police the ghetto and witches can fly on brooms. That's not science. It's medieval superstition.
Thus the telic design instantiated in life as we know it on this planet must reflect an intelligence greater than our own, which pre-existed us by a longshot. Simple deduction.
Instead of indulging in stubborn denial, shouldn't we be actively seeking this intelligence? Shouldn't science be engaged in an attempt to quantify its methods and mechanisms instead of running away from reality (screaming and waving its collective arms in the air)? Shouldn't it be curious about nature instead of trying to impose its escapist notions ON nature?
That's not what I see. I see that once one removes ideological blinders, the simple deduction becomes inescapable. Life is a product of telic design, and expresses telic design through itself and its own agency in the larger world. If you can't escape that conclusion but you're really, really unwilling to acknowledge some independent 'being' that designs by fiat (i.e., a god), you're reduced to seeking mechanism on its own terms and walling the agency off from examination [NOMA]. NDS does this with a thick brick wall around causation, which sports a skull-and-bones warning sign against all comers that reads "Random."
What a treasonous betrayal of reason! I honestly don't care what individuals choose to believe about the necessary existence of agency greater than our own, so long as they're willing to admit such agency is a necessary requirement for reality as it exists. They can call it gods, or only one God. They can call it Mother Earth or Mother Nature, Cosmic Law, All-In-One, or just the way things *are*. I don't care, and I don't think it matters a whit to what's real.
Thus I've no reason to insist that anyone buy my own beliefs about it, and no desire to try. So long as the a priori metaphysical commitments don't get in the way of our collective project to discover 'truth', all such commitments are irrelevant. It's the ones that serve as blinders or bludgeons we have to guard against, because the most pertinent 'truth' we already DO know about ourselves is that we're dangerous. To ourselves and each other, to all of life in our world, and maybe to the fabric of the whole of space and time as well.
'Truth' (if we had a handle on it) could set us free, and if we were free then all life might be set free. That 'truth' isn't the power to design bigger badder methodologies of mass death and destruction – nature herself can beat us at that handily, any time and for all time in the blink of an eye. Death isn't a very impressive (or particularly intelligent) accomplishment.
What if you were handed a 'truth' about who and what we are, on a silver platter and for no more than the price of asking? Something elegant and profound yet easily fits on a t-shirt… say, E=mc2. Now, oh man, what will you do with the knowledge? Will you serve life or mete death? Will you reach for the stars or trade your brothers' blood for power? Would it open your eyes or cover them with golden coins as you wrap a shroud of greed around yourself?
Unfortunately, we already know the answer to that riddle. There are things properly held apart from our knowledge because we've not yet proven ourselves wise enough to own them. I can certainly accept that. What I cannot accept is some great, insidious LIE that seeks to turn our own ignorance into a demon god that eats human souls for lunch and proudly proclaims itself "SCIENCE!"
TP may still be evading the implications of what he's come reluctantly to understand. There's nothing that needs doing about that, so no reason to take him further than he's ready and willing to go. The opportunity's the thing, a journey and not a goal. IMHO.
We must all walk that path for ourselves, no one can do it for us.
Comment by Joy — July 14, 2007 @ 3:08 pm
July 14th, 2007 at 4:50 pm
Hi Pez,
You wrote…
The name of the thread is the Third Choice. It is a comparison of models to at least two other choices. Right now, I only see four models on the table. NDS, YEC, the Third Choice and EAM. Do you have another candidate?
I believe the Third Choice is a viable alternative. Here is Hameroff's explaination. I started cutting and pasting the details. It got to the point that I was cutting and pasting the whole thing.
I believe EAM or the Third Choice provides a better explaination than the first two other choices. If you disagree, I would be interested in knowing which model you think provides a better explaination.
Here is link to MikeGene's web site offering a "Consilience of Clues" for front loading. I think he makes a compelling case.
I believe EAM or the Third Choice provides a better explaination for these clues than NDS or YEC. If you disagree, I would be interested in knowing which model you think provides a better explaination.
In the links I have been providing. Unfortunately, some details are only available in books like Penrose's Road to Reality and Paul Davies' Cosmic Jackpot. I would highly recomment Penrose's book. Paul Davies' is a good read, but not essential to understanding.
Better late than never… I object to you limiting the discussion to only "…the history of biological evolution". I noticed you did that at the start and should have said something then, but didn't. I wanted to give you the benefit of the doubt that you were interested in understanding the science not trying to trap me with semantics.
Libet presents an opportunaty. It is an abnormality that is not easily explained by currently models. It is like how the fact that sunlight is redshifted. Hypotheses are developed to explain them. Einstein suggested relativity. Hameroff suggests Orch OR. Big feet are easily explained by the current King-of-the-hill model. It doesn't offer anything new.
Details can be found in Hameroff's
Consciousness, neurobiology and quantum mechanics: The case for a connection
I can lead the horse to water, I can't make it drink.
I understand and agree with Dembski's logic in Chapter 7. Not because I think Dembski is an authority, but because it makes sense. If it doesn't make sense to you, I am sorry, I don't think I could add much to what Dembski said seeing that I already tried and it didn't seem to do any good.
Here is the link again.
I realise you think I have been putting Behe down. I haven't. I have been looking for a mechanisic model. I don't think Mike Gene's front-loading is "inferior" in anyway. I love the science MikeGene is doing. That is why I am supporting it, not arguing against it. The only difference is terminology. Even Dembski has a good idea or two. There are many things I disagree with Dembski about, but since he clearly isn't offering "pathetic details" or a mechanistic model, then there is no direct conflict.
As Joy has suggested, I need to think for myself. I can not accept something I can't understand. I can accept multiple metaphysical Truths because I embrace NOMA. To me science is a very dynamic king-of-the-hill game. The mechanistic hypothesis with the best explainitory power gets to temporarily hold the hill until the next hypothesis comes along.
If your intent was to put me in my place. Consider me put there. Now, what model are you offering to replace the NDS king-of-the-hill?
If you don't have one, I have a suggestion. Actually two. EAM and the Third Choice.
Comment by Thought Provoker — July 14, 2007 @ 4:50 pm
July 14th, 2007 at 5:25 pm
Hi Joy,
You wrote…
Thank you for understanding.
At the risk of getting you too comfortable.
I can assure you I am not pulling your leg.
I am doing my best to be open and honest, especially with you.
Comment by Thought Provoker — July 14, 2007 @ 5:25 pm
July 14th, 2007 at 6:02 pm
Joy:
Um, nope. You can't prove by pure reason (reinen Vernunft if you like) that such greater agency exists. So gives us the evidence or hold your peace. Your own ideological blinders are all too obvious.
Comment by Raevmo — July 14, 2007 @ 6:02 pm
July 14th, 2007 at 7:11 pm
Hi TP,
Focus, TP, focus. I've been asking about your detailed, mechanistic model, your understanding of it and your observational justification of it. You should be able to tell me about it without merely putting it on a scale opposite some other model.
It just might be.
Good. So point 1: you agree with Mike Gene's ID hypothesis about front-loaded information.
Great. I've read Cosmic Jackpot as well as The Cosmic Blueprint and God And The New Physics by Davies. Of course Davies tells us about "backward causation" that "There is no experimental evidence in favour of the theory." and "Again, observation and experiment are silent on these ideas …" page 243 and he even asks of the double-slit experiments "How should this experiment be interpreted? What it does not do is establish the possibility of backward-in-time signaling as such: no actual information can be transmitted to the past using the delayed-choice experiment." page 247.
"It is a huge leap from the delayed-choice experiment, which deals with a single photon, to the entire universe being somehow created (or at least projected into a definite, concrete form) by its own observer-participators" page 249, The Cosmic Jackpot.
As he develops the supermind, QM observer, he tells us of the three scientific choices to answer the question "why is the universe fit for life? The first is that it is a fluke. The second is that it is the result of observer selection from a multiverse. The third answer, the one I have outlined in this chapter, is that the universe has engineered its own self-awareness through quantum backward causation or some other physical mechansim yet to be discovered." 250
He tells us that we are talking more about "an idea for an idea" rather than even a "well-formulated idea". page 251 and outlines several problems with it.
And finally he says "If there is to be a complete explanation for the universe as a loop, the universe has to know and understand the laws it is responsible for in order to bring those laws into being. How could it be otherwise?"page 256.
Of course all of this relies upon a certain interpretation of QM in the first place (not the only one – with no guarantee of it being the right one).
Do you agree with my quote-mining and is this representative of where you feel we are at with regards to your model?
If so, you are talking, as I said before, about a series of hypotheses and conjectures, and drawing upon the science of the very ID-proponents whom you are dismissing for your evidential grounding.
Davies says of all the ideas he reviews:"In fact, in reviewing them they all seem to me to be either ridiculous or hopelessly inadequate: a unique universe that just happens to permit life by a fluke; a stupendous number of alternative parallel universes that exist for no reason; a preexisting God who is somehow self-explanatory; or a self-creating, self-explaining self-understanding unioverse-with-observers, entailing backward causation and teleology." page 259.
I wasn't trying to trap you with semantics. I was trying to get you to be honest.
In rejecting the status quo and arguing from the evidence of evolution you are doing nothing but restating the work of the design theorists whom you are mocking and barring from your little exercise. None of them would claim to have a 'mechanistic, naturalistic, model'. None of them think this necessary to arrive at their conclusions or flesh out their ideas.
Thank you. An 'opportunity not easily explained by current models' is not the same as claiming it as 'evidence only explained by your model', is it? You ought to strive for more accuracy.
Dembski doesn't just say "here's a probability bound".
It must be applied to something, the probability of something must be calculated – and that something is not "biological evolution".
The point is becoming moot by now, but it is simply this: you don't know that the status quo is improbable without the work of guys like Dembski and Behe. You don't even know what Dembski is claiming to be improbable. You are denigrating their positions at the same time that you are relying upon them. Your model doesn't stand without them. So what is so special about having a 'mechanistic model' when you obviously accept the science being presented by these theorists who don't offer such?
You certainly are putting Behe down.
If you had approached this with any humility and had attempted honest dialogue (instead of 'shield-bashing') you and I wouldn't even be having this discussion.
Here's your position as I see it:
You agree with ID.
MikeGene, Behe and Dembski have done a great job, along with other critics of NDS, of demonstrating the failure of the 'status quo' and implicating teleogy in the evolution of life.
MikeGene says he is talking about an idea which is not scientific, Dembski tells us that his idea of ID does not submit to the requirement of 'mechanistic explanations', Behe tells us that he does consider his work to be science, but also states that the science itself does not lead us to knowing who the designer is or how the designer operates.
You suggest that ID could be linked to a mechanism through retrocausation, QM and microtubules.
If this is your position (as I think it is) and you'd stated it as such you'd probably notice that you have a lot in common with most people here and they may discuss it openly with you or say, "eh, we can't really know about that right now, I'm going to pass on this conversation…"
But I guess you prefer your way.
Purposeful design.
Comment by Pez — July 14, 2007 @ 7:11 pm
July 14th, 2007 at 7:38 pm
Raevmo:
Gee, Raevmo. I can't find an assertion of proof in any of my posts. I did trace a reasonable deduction. Which I am free to make regardless of how uncomfortable it may make you. So it is you who should hold your peace.
I'm sure you've read my mind with ease, as that's a far more trivial magick than poofing doppelgangers into existence with a blink and a nod.
Comment by Joy — July 14, 2007 @ 7:38 pm
July 15th, 2007 at 10:52 am
I asked…
"If your intent was to put me in my place. Consider me put there. Now, what model are you offering to replace the NDS king-of-the-hill?"
Pez answered…
Lo and Behold, with these two words the movement's leaders thus rallied the faithful behind their cause.
"Fear not our righteousness" they said for those that occupy the hill of science are the aggressors, not us. It is they who refuse to see the Truth that is so obvious.
So the battle was joined, but the outcome was given since the movement was many and the occupiers were few. The infidels had but two choices, convert or perish.
When the war was done, no one remained, neither infidel nor faithful. Only a lone flag stood on the top of the hill. It was a simple flag, yet it was sufficient to hold the hill. No one was left to challenge the simple flag inscribed with the words "Purposeful Design".
Comment by Thought Provoker — July 15, 2007 @ 10:52 am
July 15th, 2007 at 1:24 pm
Hi TP,
Very pretty.
Nice to see you in your element.
"Let's do science", indeed.
Oh, by the way … what's your problem with my model?
Comment by Pez — July 15, 2007 @ 1:24 pm
July 15th, 2007 at 1:32 pm
Hi Pez,
You asked…
I don't understand it. I find it extremely difficult to embrace things I don't understand.
F=MA I can understand and embrace.
E=MC^2 I can understand and embrace.
E=H/T (Penrose OR) I can understand and embrace.
Even quanglement I can understand and embrace.
"GodDidIt" I can understand and embrace.
"OmnipotentIntelligentDesignerDidIt" I can understand and embrace.
"Purposeful Design" is meaningless to me.
P.S. I would rather do science. Which to me means comparing multiple models that explain scientific evidence and offers mechanisms/descriptions for how things work.
Comment by Thought Provoker — July 15, 2007 @ 1:32 pm
July 15th, 2007 at 1:51 pm
You don't need to embrace it but your fearful mocking reaction to things you don't understand doesn't lend itself to your latest slogan.
Having read design theorists and understood their logic and incorporated their arguments into your model what is it that you don't understand about the model?
[Edit]
P.S.
As opposed to what?
Comment by Pez — July 15, 2007 @ 1:51 pm
July 15th, 2007 at 2:01 pm
Hi Pez,
That there is a model.
I have been looking for a model. I was looking for a model in Dembski's writings. I was looking for a model in Behe's writings.
I gave up looking and wrote my own ID model. The Third Choice is an ID model.
After I started creating my model, Joy mentiones it was close to something called EAM. She also led me to Penrose and Hameroff. The Third Choice isn't "my model". It is my understanding of an ID model that doesn't presume an omnipotent designer. I also think the Third Choice is a Front Loading model, but MikeGene and Krauze have yet to rule on that one way or the other.
Comment by Thought Provoker — July 15, 2007 @ 2:01 pm
July 15th, 2007 at 2:08 pm
Hi TP,
What is the 'I' in the ID of the Penrose Hameroff (no longer 'your') model?
Comment by Pez — July 15, 2007 @ 2:08 pm
July 15th, 2007 at 3:06 pm
Hi Pez,
You asked…
I have asked multiple ID proponents multiple times for the definition of the term "Intelligence". While Joy agrees that the definition includes the attribute of an ability to learn and/or adapt many ID advocates appear to discount this as a requirement. "Purposeful Design" seems to me to be a more apt description. With, possibly, the addition of some form of consciousness.
For example, here is something from a Dembski paper, Searching Large Spaces: Displacement and the No Free Lunch Regress
"By intelligence, here, I mean something quite definite, namely, the causal factors that change one probability distribution into another and thus, in the present discussion, transform a blind search into an assisted search. A logically equivalent, information-theoretic reformulation of this definition takes intelligence as those causal factors that induce a net increase in information as measured by the information measure I. Note that by a stochastic mechanism, here, I mean any causal process governed exclusively by the interplay between chance and necessity and characterized by unbroken deterministic and nondeterministic laws.
Intelligence acts by changing probabilities. Equivalently, intelligence acts by generating information. For instance, a slab of marble temporarily has a high probability of remaining unchanged. Then, without warning, Michelangelo decides to sculpt David, and the probability of that marble slab taking on a new form (i.e., receiving new information) now changes dramatically. This definition of intelligence as the causal factors responsible for changes in probabilities or, equivalently, for net increases in information is noncircular and, on reflection, should seem unproblematic. If there is a problem, it concerns whether intelligence is reducible to stochastic mechanisms."
The shorter version of why I feel the Third Choice is a ID alternative comes from this Dembski comment posted by him on Uncommon Descent…
"…time travelers, and telic organizing principles in nature are ID alternatives that don't require God…".
Dembski has made similar comments when asked whether or not ID inherently requires an agent. EAM appears to be considered an ID alternative even if it is "…way down the totem pole for most people".
Comment by Thought Provoker — July 15, 2007 @ 3:06 pm
July 15th, 2007 at 3:53 pm
Hi TP,
Thanks for that response.
You are talking about the "I" in the PH model as being purposeful and perhaps some form of consciousness, just as ID theorists do. This factor then, in both models, can not be the discriminating one.
So then back to the question I've asked you on two different threads which always causes you to admonish me to come discuss the issue on this thread:
Why isn't "Purposeful Design" a model?
Comment by Pez — July 15, 2007 @ 3:53 pm
July 15th, 2007 at 4:53 pm
Pez:
It *is* a model, Pez. Isn't "purposeful" what "telic" means? In fact, it avoids the particular sticking points TP has with the definition of intelligence, since consciousness need not be particularly intelligent in order to be aware and seek its own purposes. I think this is just a matter of semantics and preferences.
So. If it's a matter of semantics and preferences, please do offer any version of purposeful design in life that suits your fancy! I like to examine various ideas. Some synthesis of the best of 'em is what will most likely be a viable scientific alternative in the end, I'm not 'stuck' on any of those out there right now. I've just got a couple of approaches that explain a lot and look to have real scientific potential. They could use help on various angles, so I'm open!
TP [citing Dembski]:
Yeah, yeah. Somebody's got problems with everything but their own favorite in the race. I think we need pieces-parts of several. It's a work in progress, so bring 'em on! …though I still predict what ends up being accepted by science will look a lot like EAM. They just won't call it that.
Comment by Joy — July 15, 2007 @ 4:53 pm
July 15th, 2007 at 5:09 pm
Hi Pez,
What I have outlined in this thread is what I think is an ID model with the intent of comparing it to other models (i.e. "choices"), especially the status quo model(s).
Newton developed/stole the concept of calculus in order to provide a mathematical model that corresponded with observations. He offered a description for the mechanics of planetary motion that was comparatively more understandable then previous models (e.q,. planetary spheres). I understand Newton believed this was all designed by God. You could have just as easily said "Purposeful Design" in 1687 in response to Newton's Philosophiæ Naturalis Principia Mathematica. I suggest it would have been just as meaningless as a model to Newton as it is to me, regardless of whether either or both of us agree with the sentiment.
How about we try a different tact?
What parts of the Third Choice are in direct conflict with your model?
For example, NDS and the Third Choice have a direct conflict in NDS's presumption of natural randomness.
The Third Choice is not a superset of NDS.
Is the Third Choice simply a superset of your model?
Comment by Thought Provoker — July 15, 2007 @ 5:09 pm
July 15th, 2007 at 5:09 pm
Hi Joy,
I started to write a reply to you but for every sentence I had the same response:
Yep.
Comment by Pez — July 15, 2007 @ 5:09 pm
July 15th, 2007 at 5:13 pm
Hi TP,
None.
Right.
Hmm. Maybe. Or an undetermined hypothetical add-on, perhaps.
This doesn't put the two in conflict, or make it wrong, mind you.
Comment by Pez — July 15, 2007 @ 5:13 pm
July 15th, 2007 at 7:04 pm
Pez:
LOL!!! After me own heart, are we? Just thought I'd link some sideline EAM-related bits and pieces (collected as of 2005) in case anybody's interested…
Mike Turner's EAM [Castro-Chavez]
Wired: Your DNA isn't your destiny [epigenetics]
A 21st Century view of evolution [Shapiro]
It's a fair starting place, various angles under current development. It has its interested supporters here and there… §;o)
Comment by Joy — July 15, 2007 @ 7:04 pm
July 15th, 2007 at 8:28 pm
Thanks Joy,
re: The Shapiro paper.
Looks like the "new" evolution will have to call on everything back from information theory to shades of Blythe, Lamarck and Goldschmidt.
Makes me want to say something like …
How do you like them oven-roasted cocktail franks?
Comment by Pez — July 15, 2007 @ 8:28 pm
July 15th, 2007 at 9:29 pm
Pez:
Burnt to a crisp, thanks! lol…
[true confession: I never touch the stuff, confirmed semi-vegetarian].
Comment by Joy — July 15, 2007 @ 9:29 pm